View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_75 (Length: 253)
Name: NF18936_low_75
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 36728742 - 36728977
Alignment:
| Q |
1 |
cacctttgcacaagctctcgcgaatgcttgtgacattgaacctcacgatcttctgaaaccatttgtcataattgaaaggagaaggagtggaagattgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36728742 |
cacctttgcacaagctctcgcgaatgcttgtgacatcgaacctcacgatcttctgaaaccatttgtcataattgaaaggagaaggagtggaatattgcaa |
36728841 |
T |
 |
| Q |
101 |
atttaatcttcatggtctttggatttggaataaaggtgacaagcctgatatcaaacccatttctggggagtttaccactccactagttccaaatgaaggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728842 |
atttaatcttcatggtctttggatttggaataaaggtgacaagcctgatatcaaatccatttctggggagtttaccactccactagttccaaatgaaggt |
36728941 |
T |
 |
| Q |
201 |
actatattggaatgtgaggggaattggtaacctgta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36728942 |
tctatattggaatgtgaggggaattggtaacctgta |
36728977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 2 - 146
Target Start/End: Original strand, 36715124 - 36715262
Alignment:
| Q |
2 |
acctttgcacaagctctcgcgaatgcttgtgacattgaacctcacgatcttctgaaaccatttgtcataattgaaaggagaaggagtggaagattgcaaa |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
36715124 |
acctttgcacaagctcttgcgaatgcttgtgacattgaacctcacgatcttctgaaaccatttgtcataattga------aaggagtggaagattgaaaa |
36715217 |
T |
 |
| Q |
102 |
tttaatcttcatggtctttggatttggaataaaggtgacaagcct |
146 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
36715218 |
tttattcttcatggtcgttggattttgaataaaggtgacaggcct |
36715262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University