View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18936_low_83 (Length: 250)

Name: NF18936_low_83
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18936_low_83
NF18936_low_83
[»] chr3 (1 HSPs)
chr3 (57-205)||(45637739-45637887)
[»] chr7 (2 HSPs)
chr7 (121-229)||(11648727-11648835)
chr7 (1-52)||(11648069-11648120)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 57 - 205
Target Start/End: Original strand, 45637739 - 45637887
Alignment:
57 gctagggtgtgcaatagggtagtcaagactacttaccataaacttaatgcattctgaatcattagaaaattattttgcaatgagctgaagtattcaaatt 156  Q
    ||||||||||||||| ||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||  ||||| ||||||||     
45637739 gctagggtgtgcaatggggtagtcaagactacttaacataaactttatgcattccgaatcattagaaaattattttgcaatgaaatgaagcattcaaatc 45637838  T
157 atgattcaataaagaataatcagggagagtgcaaaacactgatattcaa 205  Q
    |||| ||||||||||||||||||| ||||||||||||||||||||||||    
45637839 atgactcaataaagaataatcaggaagagtgcaaaacactgatattcaa 45637887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 121 - 229
Target Start/End: Original strand, 11648727 - 11648835
Alignment:
121 gaaaattattttgcaatgagctgaagtattcaaattatgattcaataaagaataatcagggagagtgcaaaacactgatattcaattggatttaccttgt 220  Q
    ||||||||||||||||| |  ||||| |||||||| |||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
11648727 gaaaattattttgcaataaaatgaagcattcaaatcatgattcaatgaagaataatcatggagagtgcaaaccactgatattcaattggatttaccttgt 11648826  T
221 tagctgcaa 229  Q
    ||| |||||    
11648827 tagttgcaa 11648835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11648069 - 11648120
Alignment:
1 attaattgaatgaatatatttgtaaaaacgcttcaattcattatagtaaact 52  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||    
11648069 attaattgaatgaatatatttgtaaaaacatttcaattcattatagtaaact 11648120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University