View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18936_low_88 (Length: 244)

Name: NF18936_low_88
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18936_low_88
NF18936_low_88
[»] chr7 (1 HSPs)
chr7 (18-135)||(11575294-11575411)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 18 - 135
Target Start/End: Complemental strand, 11575411 - 11575294
Alignment:
18 gatgcaagtccattctctaaacggtgtggtgaacctttaatttagcttacatataggggataaacaatacatctaatttgtatttatgtgtgtatatgtt 117  Q
    ||||||||| |||| |||||||  |||||||||||||||||| | ||||||||||||||||||||||||||||||||||  |||||||||||||||||||    
11575411 gatgcaagtgcattttctaaactatgtggtgaacctttaattgaccttacatataggggataaacaatacatctaatttaaatttatgtgtgtatatgtt 11575312  T
118 aataattaaataatgcaa 135  Q
    ||||||||| ||||||||    
11575311 aataattaagtaatgcaa 11575294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University