View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_88 (Length: 244)
Name: NF18936_low_88
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 18 - 135
Target Start/End: Complemental strand, 11575411 - 11575294
Alignment:
| Q |
18 |
gatgcaagtccattctctaaacggtgtggtgaacctttaatttagcttacatataggggataaacaatacatctaatttgtatttatgtgtgtatatgtt |
117 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11575411 |
gatgcaagtgcattttctaaactatgtggtgaacctttaattgaccttacatataggggataaacaatacatctaatttaaatttatgtgtgtatatgtt |
11575312 |
T |
 |
| Q |
118 |
aataattaaataatgcaa |
135 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
11575311 |
aataattaagtaatgcaa |
11575294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University