View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_94 (Length: 240)
Name: NF18936_low_94
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_94 |
 |  |
|
| [»] scaffold0391 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0391 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 87 - 228
Target Start/End: Original strand, 6997 - 7138
Alignment:
| Q |
87 |
taagtttaatacgtttattgtatactagtcaatacacatggtcatgcagtgcaacgaattttctttcgtaagaaccatcattttccattatggaaacctg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6997 |
taagtttaatacgtttattgtatactagtcaatacacatggtcatgcagtgcaacgaattttctttcgtaagaaccatcattttccattatgaaaacctg |
7096 |
T |
 |
| Q |
187 |
cgcaaagagttgataacaaaattgctacgttatttctttgtg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7097 |
cgcaaagagttgataacaaaattgctacgttatttctttgtg |
7138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 6940 - 6986
Alignment:
| Q |
9 |
cacagaaattgacgatgtgggtcacgtttatagtttaatacgttttt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6940 |
cacagaaattgacgatgtgggtcacgtttatagtttaatacgttttt |
6986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University