View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18937_high_19 (Length: 240)
Name: NF18937_high_19
Description: NF18937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18937_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1191916 - 1192139
Alignment:
| Q |
1 |
tatcaatgtgtacgcttccacaactaaaccagcacgacccaaaagatccaccatgcaaccataacgttttattgtaggtttgatgttataatctctattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1191916 |
tatcaatgtgtacgcttccacaactaaaccagcacgacccaaaagatccaccatgcaaccataacgttttattgtaggtttgatgttataatatctattc |
1192015 |
T |
 |
| Q |
101 |
ataatatcaaaatatcgtcttccatcatcaaccaaccctccatgactacaagcacacaatacacccaagaagtaatttcgtctagcctctcaacattctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1192016 |
ataatatcaaaatatcgtcttccatcatcaaccaaccctccatgactacaagcacacaatacacccaagaagtaatttcgtctagcctctcaacattctc |
1192115 |
T |
 |
| Q |
201 |
gcgtcctcgtgaagagggctaaag |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1192116 |
gcgtcctcgtgaagagggctaaag |
1192139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 11 - 201
Target Start/End: Original strand, 155549 - 155740
Alignment:
| Q |
11 |
tacgcttccacaactaaaccagcacgacccaaaagatccaccatgcaaccataacgttttattgtaggtttgatgttataatctctattcataatatcaa |
110 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
155549 |
tacgcttctacaaataaaccagcacgacccaaaaggtccaccatgcacccataatgttttattgtaggtttgatgttatagtctctattcataatttcaa |
155648 |
T |
 |
| Q |
111 |
aatatcgtcttccatcatcaaccaaccctccatgactacaagcacacaatacacccaag-aagtaatttcgtctagcctctcaacattctcg |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
155649 |
aatatcgtcttccttcatcaaccaaccctccatgactacaagcacacaatacacataagaaagtaatttcgtctggcctctcaacattctcg |
155740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University