View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18937_low_21 (Length: 236)
Name: NF18937_low_21
Description: NF18937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18937_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 23213530 - 23213748
Alignment:
| Q |
18 |
acacatagcagctagtaggtgagaatctatggggcatccaacattggctaagtttactaacaacataggatattttaggcctagagtgtgaggtatagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23213530 |
acacatagcagctagtaggtgagaatctatggggcatccaacattggctaagtttactaacaacataggatattttaggcctagagtgtgaggtatagga |
23213629 |
T |
 |
| Q |
118 |
gttcccaatcgtgtaactaaactctacaaaactgatttgtaaaatcatagacgtctcctagttacaaagtcatttataagtcatatctcatcatatgtta |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23213630 |
gttcccaatcgtgtaactcaactctacaaaactgatttgtaaaatcatagacgtctcctagttacaaagtcatttataagtcatatctcatcatatgtta |
23213729 |
T |
 |
| Q |
218 |
gactattaacacacccctc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23213730 |
gactattaacacacccctc |
23213748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University