View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18937_low_23 (Length: 227)
Name: NF18937_low_23
Description: NF18937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18937_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 122 - 175
Target Start/End: Complemental strand, 3854983 - 3854932
Alignment:
| Q |
122 |
ataatagaagaaattatagagaaagattttattgaaaaaatagtggggttgaca |
175 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
3854983 |
ataatagaagaaattatggaga--gattttattgaaaaaatagtggggttgaca |
3854932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 210
Target Start/End: Complemental strand, 3854904 - 3854872
Alignment:
| Q |
178 |
gttttcacttgtgtcgtggtggcgccgtgtttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3854904 |
gttttcacttgtgtcgtggtggcgccgtgtttt |
3854872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University