View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18939_high_3 (Length: 390)
Name: NF18939_high_3
Description: NF18939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18939_high_3 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 165 - 390
Target Start/End: Complemental strand, 48718694 - 48718469
Alignment:
| Q |
165 |
gttcaacgacggtggattcagcaaagccaccctgagtgatcttgccgtcagtgtaaacatcattgtaagaccagatcttcttgttacagtattgctcaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48718694 |
gttcaacgacggtggattcagcaaagccaccctgagtgatcttgccgtcagtgtaaacatcattgtaagaccagatcttcttgttacagtattgctcaat |
48718595 |
T |
|
| Q |
265 |
ctcagaatcacatgctctgcagcttttgcaacaaccgacgagaagaccaactcccacaatttctcccactttgaaccttgtaacgtttgaacccacctct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48718594 |
ctcagaatcacatgctctgcagcttttgcaacaaccaacgagaagaccaactcccacaatttctcccactttgaaccttgtaacatttgaacccacctct |
48718495 |
T |
|
| Q |
365 |
agtacctcaccaaccacttcatgcct |
390 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48718494 |
agtacctcaccaaccacttcatgcct |
48718469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 48718862 - 48718761
Alignment:
| Q |
1 |
gatttgataataagttgaaaataatctaaagagacataaaatcatcaatgttttttaaatgggttttcaaaaatggataaaacgtgtggaattttaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48718862 |
gatttgataataagttgaaaataatctaaagagacatcaaatcatcaatgttttttaaatgggttttcaaaaatggataaaacgtgtggaattttaaatt |
48718763 |
T |
|
| Q |
101 |
aa |
102 |
Q |
| |
|
|| |
|
|
| T |
48718762 |
aa |
48718761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University