View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1893_low_11 (Length: 341)
Name: NF1893_low_11
Description: NF1893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1893_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 329
Target Start/End: Original strand, 2984322 - 2984636
Alignment:
| Q |
18 |
agtgtgtacatattttgtaaaatttggccatgtcattgaaacatgttataaaaatgatcattttgtccacaaatttcttagtatcttgtcgaaattttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2984322 |
agtgtgtacatattttgtaaaatttggccatgtcattgaaacatgttataaaaatgatcattttatccacaaatttcttagtatcttgtcgaaattttta |
2984421 |
T |
 |
| Q |
118 |
tgcaaacaattcagagagtgaagccaaattcaactatcattgttctttaaaggaactataagaccctagtccacctgtttttactctggatcagtaagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2984422 |
tgcaaacaattcagagagtgaagccaaattcaactatcattgttctttaaaggaactataagaccctagtccacctgtttttactctggatcagtaagta |
2984521 |
T |
 |
| Q |
218 |
tatcagatggtttgcactgattcaacatgcatcatagttgattaatcaagctagcctcactgtcacaattctgatt---cagcgtttatcagattgtctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
2984522 |
tatcagatggtttgcactgattcaacatgcatcatagttgattaatcaagctagcctcactgtcacaactctgattcagcagcgtatatcagattgtctt |
2984621 |
T |
 |
| Q |
315 |
acatggttttgttca |
329 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2984622 |
acatggttttgttca |
2984636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University