View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1893_low_14 (Length: 273)
Name: NF1893_low_14
Description: NF1893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1893_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 49627864 - 49627617
Alignment:
| Q |
16 |
tatccttcttatttatttttatgattgttcaaggatgatccccgtaaacctcatttaccaatagtttttacgtgtagaaatattcttctttacatgtttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49627864 |
tatccttcttatttatttttatgattgttcaaggatgatccccgtaaacctcatttcccaatagtttttacgtgtagaaatattcttctttagatgtttg |
49627765 |
T |
 |
| Q |
116 |
ctggtgaagtaaccacaatactcacggaaagaacaaagaaaattagacgaggataatgacgcagagagtgaggtggcat-nnnnnnnccagtttatgtgc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
49627764 |
ctggtgaagtaaccacaatactcacggaaagaacaaagaaaattagacgaggataatgacgcagagagtgaagtggcataaaaaaaaccagtttatgtgc |
49627665 |
T |
 |
| Q |
215 |
attgccctcagataattttgatttccaatatatccaaaaccagttcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49627664 |
attgccctcagataattttgatttccaatatatccaaaaccagttcat |
49627617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University