View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1893_low_16 (Length: 247)
Name: NF1893_low_16
Description: NF1893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1893_low_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 38 - 161
Target Start/End: Complemental strand, 24700511 - 24700388
Alignment:
| Q |
38 |
tactaaaactaataacaaatagaaatacaaatatgttggctcgggaatttgttgggaagaggatgaaactgaaagcagatgattcatatagtgttactga |
137 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| ||| |
|
|
| T |
24700511 |
tactaaaactaaccacaaatagagatacaaatatgttggctcggggatttgttgggaagaggatgaaactgaaaacaggtgattcatatagtgttattga |
24700412 |
T |
|
| Q |
138 |
tttccatgtgcaaggagggattat |
161 |
Q |
| |
|
||||||| | || |||||||||| |
|
|
| T |
24700411 |
tttccatacgtaatgagggattat |
24700388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 190 - 247
Target Start/End: Complemental strand, 36236188 - 36236131
Alignment:
| Q |
190 |
gtcatgaacctggtgtgagcgcttatataggattggacaatcctcccctttgagccat |
247 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
36236188 |
gtcatgaacctcgtgtgagggtttatataggattgggcaatcctcccctttcagccat |
36236131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 230
Target Start/End: Complemental strand, 17250880 - 17250843
Alignment:
| Q |
193 |
atgaacctggtgtgagcgcttatataggattggacaat |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
17250880 |
atgaacctggtgtgagggcttatataggattgggcaat |
17250843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University