View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1893_low_3 (Length: 510)
Name: NF1893_low_3
Description: NF1893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1893_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 339 - 452
Target Start/End: Original strand, 51189571 - 51189684
Alignment:
| Q |
339 |
ttaacatagttaatggtctcaaccgtcaattatcgaactgccaagacaaatagtgcatgacttggttacttgtaatccaaatcgattaatgtgccactct |
438 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189571 |
ttaacatagttaatggtctcaaccgtcaattatcgaactgccaagacaaatagtgcatgacttggttacttgtaatccaaatcgattaatgtgccactcg |
51189670 |
T |
|
| Q |
439 |
tccactcctaattg |
452 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51189671 |
tccactcctaattg |
51189684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 464 - 500
Target Start/End: Original strand, 51189702 - 51189738
Alignment:
| Q |
464 |
gcaaacagtgacattattatcataatgagatgatgat |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189702 |
gcaaacagtgacattattatcataatgagatgatgat |
51189738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University