View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1893_low_6 (Length: 413)
Name: NF1893_low_6
Description: NF1893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1893_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 36733642 - 36733450
Alignment:
| Q |
1 |
acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733642 |
acttcgatttcttgtattttcttgtgagtatggcttttacaaaaattgttgatactagccatatgatgaaaagtaagatgtaaccttggtaatcaaccat |
36733543 |
T |
|
| Q |
101 |
gttattgtaaccnnnnnnnnngttgtagtaagtaattgaaaatatgttggttacgctgctgaattgtatc----gtatataagaaggaaaaaact |
191 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36733542 |
gttattgtaacctttttttt--tagtagtaagtaattgaaaatatgttggttacgctgctgaattgtatcgtatgtatataagaaggaaaaaact |
36733450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 256 - 399
Target Start/End: Complemental strand, 36733429 - 36733286
Alignment:
| Q |
256 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaannnnnnnnaggaaggccaaggacggcaacatattcttaaaacgtatgact |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733429 |
atcatattcgttatttgatttggaaaaggacgattatgtgttgctctcaagtttttttaggaaggccaaggacggcaacatattcttaaaacgtatgact |
36733330 |
T |
|
| Q |
356 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36733329 |
gattccaaactaggaagaatataaaatgtcaccgaatgtctgtg |
36733286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 239
Target Start/End: Complemental strand, 36733450 - 36733417
Alignment:
| Q |
206 |
ttatattgtagtttgtgtttgatcatattcgtta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36733450 |
ttatattgtagtttgtgtttgatcatattcgtta |
36733417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University