View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18940_low_9 (Length: 237)
Name: NF18940_low_9
Description: NF18940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18940_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 44700160 - 44699959
Alignment:
| Q |
18 |
atgacaatgccaaaagttatctaaagtatgctcgttcacccgttttgacaatcttagcggtgtgcgagagcagataatgaagctagtgaactactacaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44700160 |
atgacaatgccaaaagttatctaaagtatgctcgttcacccgttttgacaatcttagcggtgtgcgagagcagataatgaagctagtgaactactacaat |
44700061 |
T |
|
| Q |
118 |
aactctaaggatcttaaggttgaaattagtgagagcaccttgatgtccttgagtcatatcctcctcactttgatgttacgaggacttcttacaataccta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44700060 |
aactctaaggatcttaaggttgaaattagtgagagcaccttgatgtccttgagtcatatcctcctcactttgatgttacgaggacttcttacaataccta |
44699961 |
T |
|
| Q |
218 |
aa |
219 |
Q |
| |
|
|| |
|
|
| T |
44699960 |
aa |
44699959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 71 - 161
Target Start/End: Original strand, 44699013 - 44699103
Alignment:
| Q |
71 |
ttagcggtgtgcgagagcagataatgaagctagtgaactactacaataactct-aaggatcttaaggttgaaattagtgagagcaccttgat |
161 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||| ||||||| | ||| ||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
44699013 |
ttagcggtgtgcgagagcatatcatgaagctattgaactgctacaatga-tctgaaggatcttaaggtttaaattgatgagagcgccttgat |
44699103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University