View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18941_high_9 (Length: 250)
Name: NF18941_high_9
Description: NF18941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18941_high_9 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 114 - 250
Target Start/End: Complemental strand, 783566 - 783430
Alignment:
| Q |
114 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatgaatccttacacatcaaaaggttgctt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
783566 |
tttagcatttgtcacataaataaatgtgataatataagtacatgcattacatacccaattaagcaagcattatcaatccttacacatcaaaaggttgctt |
783467 |
T |
 |
| Q |
214 |
accagtaaatttaacctcaattgggctaacattcttc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783466 |
accagtaaatttaacctcaattgggctaacattcttc |
783430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 783656 - 783620
Alignment:
| Q |
18 |
attactaataaaagctaaagcggattaatattcattc |
54 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
783656 |
attactaataaaagctaaagcagattaatattcattc |
783620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University