View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18943_high_21 (Length: 233)

Name: NF18943_high_21
Description: NF18943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18943_high_21
NF18943_high_21
[»] chr6 (1 HSPs)
chr6 (1-145)||(28920176-28920320)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 28920176 - 28920320
Alignment:
1 tttggagggatgaattgatctgtggttagcagaatggttggatatttgagtgtaattttttactgaataatttctttatgtccaagcgtannnnnnngtt 100  Q
    ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||  ||       |||    
28920176 tttggagggatgaattgatctgtggttagcagaatggctggatgtttgagtgtaattttttactgaataatttctttatgtccaagtatatttttttgtt 28920275  T
101 gaattctcttggtgttagtatgttttttgatcatacattaagttt 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
28920276 gaattctcttggtgttagtatgttttttgatcatacattaagttt 28920320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University