View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18943_low_11 (Length: 309)
Name: NF18943_low_11
Description: NF18943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18943_low_11 |
 | |
|
| [»] scaffold0077 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0077 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: scaffold0077
Description:
Target: scaffold0077; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 294
Target Start/End: Original strand, 10339 - 10617
Alignment:
| Q |
16 |
atccaacgaccaaaacaaaactcactgtaccttctgtccgatgaaaaaaccaggcacgggagtggcacgtggcgacctgagaggaaattcattcacctgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10339 |
atccaacgaccaaaacaaaactcactgtaccttctgtccgatgaaaaaaccaggcacgggagtggcacgtggcgacctgagaggaaattcattcacctgt |
10438 |
T |
|
| Q |
116 |
ttccccttattgtcataataaatcacaccagagaaatccaacggttcacacttatcacccatcaagatcgttttctgccaaacaccaccatcaccccact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10439 |
ttccccttattgtcataataaatcacaccagagaaatccaacggttcacacttatcacccatcaagatcgttttctgccaaacaccaccatcaccccact |
10538 |
T |
|
| Q |
216 |
ccaacttccctttctttttcttcttcatcttctcaataaacggcatagctttgttgcttatgtttttcagcaacttctt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10539 |
ccaacttccctttctttttcttcttcatcttctcaataaacggcatagctttgttgcttatgtttttcagcaacttctt |
10617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 198
Target Start/End: Original strand, 46221273 - 46221359
Alignment:
| Q |
112 |
ctgtttccccttattgtcataataaatcacaccagagaaatccaacggttcacacttatcacccatcaagatcgttttctgccaaac |
198 |
Q |
| |
|
||||||||| ||| | || || ||||||||||| |||||||||||||| |||||||| | |||||||| ||| ||||||||||| |
|
|
| T |
46221273 |
ctgtttcccgttaatatcgtagtaaatcacaccggagaaatccaacggctcacactttcctcccatcaaaatctccttctgccaaac |
46221359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University