View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18943_low_13 (Length: 290)
Name: NF18943_low_13
Description: NF18943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18943_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 12952685 - 12952423
Alignment:
| Q |
18 |
aagaagaccattacaagtaacagcatcaccgatttcagaattcgagagagcaaatctaatttcatgggctagacaacttgctcataatggaaaactcttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12952685 |
aagaagaccattacaagtaacagcatcaccgatttcagaattcgagagagcaaatctaatttcatgggctagacaacttgctcataatggaaaactcttg |
12952586 |
T |
|
| Q |
118 |
gatcttgttgatagttctatacattctttggataaagaacaagcattgctatgtatcaccattgcattgctatgtttgcagagatctcctgggaaaaggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12952585 |
gatcttgttgatagttctatacattctttggataaagaacaagcattgctatgtatcaccattgcattgctatgtttgcagagatctcctgggaaaaggc |
12952486 |
T |
|
| Q |
218 |
cttccatgaaggagattgtagggatgctttctggtgaagctgacccacctcacttgccctttg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12952485 |
cttccatgaaggagattgtagggatgctttctggtgaagctgacccacctcacttgccctttg |
12952423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University