View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18943_low_23 (Length: 233)
Name: NF18943_low_23
Description: NF18943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18943_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 28920176 - 28920320
Alignment:
| Q |
1 |
tttggagggatgaattgatctgtggttagcagaatggttggatatttgagtgtaattttttactgaataatttctttatgtccaagcgtannnnnnngtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
28920176 |
tttggagggatgaattgatctgtggttagcagaatggctggatgtttgagtgtaattttttactgaataatttctttatgtccaagtatatttttttgtt |
28920275 |
T |
 |
| Q |
101 |
gaattctcttggtgttagtatgttttttgatcatacattaagttt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28920276 |
gaattctcttggtgttagtatgttttttgatcatacattaagttt |
28920320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University