View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18943_low_25 (Length: 224)
Name: NF18943_low_25
Description: NF18943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18943_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 3880408 - 3880207
Alignment:
| Q |
1 |
cccaggaatgaaaagaaacctaatctctcacagatacaacagccagaaaagttgagacattatcccaaggatcatctaccgctaaacactgatagtaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880408 |
cccaggaatgaaaagaaacctaatctctcacagatacaacagccagaaaagttgagacattatcccaaggatcatctaccgctaaacactgatagtaaca |
3880309 |
T |
 |
| Q |
101 |
actaataatgattcatgcaattatttcaactaaagtcacaaatttcagtaattctttaaactgattttgtgagaataccaagaataccctttcataaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3880308 |
actaataatgattcatgcaattatttcaactaaagtcacaaatttcagtagttctttaaactgattttgtgagaataccaagaataccctttcataaact |
3880209 |
T |
 |
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
3880208 |
tc |
3880207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University