View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_high_21 (Length: 280)
Name: NF18945_high_21
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 10 - 265
Target Start/End: Original strand, 29398779 - 29399034
Alignment:
| Q |
10 |
catcatcattcatcatccacactagctagacttcccttgtttcttctccacatagcaaaactaacaatgtcttcttcagatgaatcctttgttgctcatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29398779 |
catcatcattcatcatccacactagctagacttcccttgtttcttctccacatagcaaaactaacaatgtcttcttcagatgaatcctttgttgctcatg |
29398878 |
T |
 |
| Q |
110 |
tagctttccttccaagttctggtctaggtcatctcaatccatgtctaagaacagctgagttatttcttcgttatggctgcaaaatcactctcatcacacc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29398879 |
tagctttccttccaagttctggtctaggtcatctcaatccatgtctaagaacagctgagttatttcttcgttatggctgcaaaatcactctcatcacacc |
29398978 |
T |
 |
| Q |
210 |
aaaaccaacaatctctttagctgaatcagacctcatcactcagttttgttcttctt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29398979 |
aaaaccaacaatctctttagctgaatcagacctcatcactcagttttgttcttctt |
29399034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University