View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18945_high_23 (Length: 266)

Name: NF18945_high_23
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18945_high_23
NF18945_high_23
[»] chr4 (1 HSPs)
chr4 (31-256)||(35202593-35202818)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 31 - 256
Target Start/End: Original strand, 35202593 - 35202818
Alignment:
31 ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202593 ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg 35202692  T
131 ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35202693 ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg 35202792  T
231 tagttaatcttaatcatcatgatgat 256  Q
    ||||||||||||||||||||||||||    
35202793 tagttaatcttaatcatcatgatgat 35202818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University