View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_high_28 (Length: 246)
Name: NF18945_high_28
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 21 - 233
Target Start/End: Original strand, 605580 - 605780
Alignment:
| Q |
21 |
aatatctcaatgaccgattcttccatattcaacaaccgcaaaatctcttatcccttccactgctgttgttcataatcttcataagcacaacccaatttca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
605580 |
aatatctcaatgaccgattcttccatattcaacaaccgcaaaatctcttatcccttccactgttgttgttcataatcttcataagcacaacccaatttca |
605679 |
T |
 |
| Q |
121 |
tcgcagcattgtttcttcaatttctcatcgtgtttctgtttgtgtttgtgtttgatggatctatcacaccatcaatccaatttatctctcaatttctcat |
220 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
605680 |
tcccagcattgtttcttcaatttctcatc------------gtgtttgtgtttgatggatctatcacaccatcaatccaatttatctctcaatttctcat |
605767 |
T |
 |
| Q |
221 |
cttctcacgcttc |
233 |
Q |
| |
|
||||||||||||| |
|
|
| T |
605768 |
cttctcacgcttc |
605780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University