View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_high_6 (Length: 457)
Name: NF18945_high_6
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 18 - 452
Target Start/End: Original strand, 33709108 - 33709543
Alignment:
| Q |
18 |
ccctcacactttccctcccatcgtctcttttgttttcttcctcacaaatatttttgcttccaaaactccaaaaccacgcacgcacgcttc-cccaaatta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33709108 |
ccctcacactttccctcgcatcgtctcttttgttttcttcctcacaaatatttttgcttccaaaactccaaaaccacgcacgcacgcttctcccaaatta |
33709207 |
T |
|
| Q |
117 |
ggtataaaccaccaccagatctggttatcatctcattccaccgccgcaccggagattcattccattgcattccgtggcatgatcttagcgccgctgttct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33709208 |
ggtataaaccaccaccagatctggttatcatctcattccaccgccgcaccggagattcattccattgcattccgtggcatgatcttagcgccgctgttct |
33709307 |
T |
|
| Q |
217 |
tgattctgaaatatttatagctcgctcgctcgctcaatgtctgccatggatttaatctggagagggaacgacaatgtggttccagacgcttctcatttct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33709308 |
tgattctgaaatatttatagctcgctcgctcgctcaatgtctgccatggatttaatctggagagggaacgacaatgtggttccagacgcttctcatttct |
33709407 |
T |
|
| Q |
317 |
ccgtcgcgatctacttcgcttttggtagtttggccgctaggttcatgcttgatagattcgtctttcgcgtaagaatttcattcctttcgttcctaccttg |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33709408 |
ccgtcgcgatctacttcgcttttggtagtttggccgctaggttcattcttgatagattcgtctttcgcgtaagaatttccttcctttcgttcctaccttg |
33709507 |
T |
|
| Q |
417 |
ttctaatattaattattatttgctaattcatctctc |
452 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33709508 |
ttctaatattaattattatttgctaattcttctctc |
33709543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University