View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_17 (Length: 322)
Name: NF18945_low_17
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_17 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 52 - 311
Target Start/End: Original strand, 13945 - 14186
Alignment:
| Q |
52 |
caatgtttataattaaaagtaaaaataagaaatgaatacaaagaatgaaaacaaagatcaaacaagggatcaagattatggtcactgtcatggtggtggt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13945 |
caatgtttataattaaaagtaaaaataagaaatgaatacaaagaatgaaaacaaagatcaaacaagggatcaagattctggtcactgtcatggtggtggt |
14044 |
T |
 |
| Q |
152 |
tactcagatgaacatatttaaagaaaagtttacaagtttgatgattttgatatttagagttctagattttgacaatgtgctgtcaaaaggcattgattaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14045 |
tactcagatgaacatatttaaagaaaagtttacaagtttgatgattttgatatttagagttctagattttgacaatgtgctgtcaaaaggcattgat--- |
14141 |
T |
 |
| Q |
252 |
cagactaatttctagattacaacaatttgcacttcgtctgcttcactcgttacgctttca |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14142 |
---------------attacaacaatttgcacttcgtctgcttcactcgttacgctttca |
14186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University