View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_20 (Length: 303)
Name: NF18945_low_20
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 13 - 286
Target Start/End: Original strand, 49189812 - 49190085
Alignment:
| Q |
13 |
aatatcaaagaataggaatacaaacatacacatctatattttctctcatattggtttgtttaccactatcttttatttggatcaacattaagaacatact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
49189812 |
aatatcaaagaataggaatacaaacatacacatctatattttctctcatattggtttgtttaccactatcttttatttggatcaacattgagagcatact |
49189911 |
T |
 |
| Q |
113 |
agttttcacaggacaagaccctctaattgcacatgaagcaggaagattcacaatttggcttcttccagcactttttgcatatgcaatattgcaaccacta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49189912 |
agttttcacaggacaagaccctctaattgcacatgaagcaggaagattcacaatttggcttcttccagcactttttgcatatgcaatattgcaaccacta |
49190011 |
T |
 |
| Q |
213 |
gttagatattttcaaatacaaagcttgcttattccaatgcttttaagctcttgtgtcactctttgtatccatat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49190012 |
gttagatattttcaaatacaaagcttgcttattccaatgcttttaagctcttgtgtcactctttgtatccatat |
49190085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University