View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_23 (Length: 267)
Name: NF18945_low_23
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 12 - 267
Target Start/End: Original strand, 7704860 - 7705115
Alignment:
| Q |
12 |
atgaatagagtttaattcattaatgtaatgggatgggtacgttgaattgttgatttaattacggatgtctcatgatcactaagtatcctacgacgatatt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7704860 |
atgaatagagtttaattcattaatgtaatgggatgggtacgttgaattgttgatttaattagggatgtctcatgatccctaagtatcctacgacgatatt |
7704959 |
T |
|
| Q |
112 |
gttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttcctttcattctatttcatctgaattcgatgatgaattcttttttgaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7704960 |
gttacgaattaggttttgttcattctattcccctgttcaaaggttttagtttcctttcattctatttcatctgaattcgatgatgaattcttttttgaaa |
7705059 |
T |
|
| Q |
212 |
ttttgcttatctatagttactttgctggacaacatcattgaacattttctcagaac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7705060 |
ttttgcttatctatagttactttgctggacaacatcattgaacattttctcagaac |
7705115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University