View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_24 (Length: 266)
Name: NF18945_low_24
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 31 - 256
Target Start/End: Original strand, 35202593 - 35202818
Alignment:
| Q |
31 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202593 |
ccatagttttgatattgcttctacctcaaaccatatcaattctcttctttatggtaactcttcttgtcatgatgtgatgaactttccttttgcaacaagg |
35202692 |
T |
 |
| Q |
131 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35202693 |
ttcaattctacaagagtttcaagttcttcttctggttatgatcatcttcagcagcagcagcctcaggtgaatggtcttggattaggtttttcatctgggg |
35202792 |
T |
 |
| Q |
231 |
tagttaatcttaatcatcatgatgat |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35202793 |
tagttaatcttaatcatcatgatgat |
35202818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University