View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_26 (Length: 252)
Name: NF18945_low_26
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 3741480 - 3741268
Alignment:
| Q |
18 |
ataggaaattcgtttccttaatagaaaattaattactcaataaaataaattattagatggtacatttcttccagttagcaattcacattaggaaaaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3741480 |
ataggaaattcgtttccttaatagaaaattaattactcaataaaataaattattagatggtacatttcttccagttagcaattcacattaggaaaaaatt |
3741381 |
T |
 |
| Q |
118 |
caaacgcagttcattgcacttattttaccgctctc-nnnnnnnnttctcgagtgacatgttaaaatttgggtttaatttatacagttttttctacatata |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3741380 |
caaacgtagttcattgcacttattttaccgctctcaaaaaaaaattctcgtgtgacatattaaaatttgggtttaatttatacagttttttctac--ata |
3741283 |
T |
 |
| Q |
217 |
tatatctaatgatgt |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3741282 |
tatatctaatgatgt |
3741268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University