View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18945_low_5 (Length: 519)
Name: NF18945_low_5
Description: NF18945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18945_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 32 - 281
Target Start/End: Original strand, 29654110 - 29654359
Alignment:
| Q |
32 |
cacgtacattcagaccggttnnnnnnnggatggaaccaaagtccatataaaatgacagatttgcattggcagaattagtttggatcattagcgacatatg |
131 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29654110 |
cacgtacattcagaccagttaaaaaaaggatggaaccaaagtccatataaaatgacagatttgcattggcagaattggtttggatcattagcgacatatg |
29654209 |
T |
|
| Q |
132 |
cttctatagaagtaagtgggttgaaatattgccaaagggctgcagagcctatgacatgatgataagttctggattgattttggaggctagctattgctag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29654210 |
cttctatagaagtaagtgggttgaaatattgccaaagggctgcagagcctatgccatgatgataagttctggattgattttggaggctagctattgctag |
29654309 |
T |
|
| Q |
232 |
tttgtatttgtacattgaagtttctcatcttgtgattgttgttgctcctg |
281 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29654310 |
tttgtatctgtacattgaagtttctcattttgtgattgttgttgctcctg |
29654359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 133; E-Value: 6e-69
Query Start/End: Original strand, 347 - 507
Target Start/End: Original strand, 29654425 - 29654585
Alignment:
| Q |
347 |
gatcatattttggatttattactttgacacgtggtttaatgaatttttctcgttttggctttcctcaagataccaactactgggatttgttagtcacgtt |
446 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
29654425 |
gatcatattttggatttattactttgacatgtggtttaatgaatttttctctttttggctttcctcaggatatcaactactgggatttgtcagtcacgtt |
29654524 |
T |
|
| Q |
447 |
agatcatcaatggatactggtcactatgttgcatatgtccgtaaacttgatagatgggttc |
507 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29654525 |
ggatcatcaatggatactggtcactatattgcatatgtccgtaaacttgatagatgggttc |
29654585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University