View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18946_high_8 (Length: 239)
Name: NF18946_high_8
Description: NF18946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18946_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 6822024 - 6821807
Alignment:
| Q |
18 |
ctaaatgcataccaaaataccgactgtggtttgttctgctgttgttttgcaagataatttctctgagcatacttggaagacaacatgtcttaattttgcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6822024 |
ctaaatgcataccaaaataccgactgtggtttgttctgctattgttttgcaagataatttctttgagcatacttggaagacaacatgtcttaattttgcc |
6821925 |
T |
|
| Q |
118 |
attgggctttagtgctacaacttgaatcatgctacggtctctcaactcttctaggtaactttctgcagtctcttcgggtgtgttctgatcgttctgtact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6821924 |
attgggctttagtgctacaacttgaatcatgctacggtctctcaactcttctaggtaactttctgcagtctcttcgggtgtgttctgatcgttctgtact |
6821825 |
T |
|
| Q |
218 |
tgcacctatgcttctcca |
235 |
Q |
| |
|
|||||| || |||||||| |
|
|
| T |
6821824 |
tgcaccaatccttctcca |
6821807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 35 - 198
Target Start/End: Complemental strand, 7334307 - 7334144
Alignment:
| Q |
35 |
taccgactgtggtttgttctgctgttgttttgcaagataatttctctgagcatacttggaagacaacatgtcttaattttgccattgggctttagtgcta |
134 |
Q |
| |
|
|||||||| ||| |||||||| |||| ||||||||||| ||||||||||||||||| || || | ||||||||||| || ||||| ||||||||| | |
|
|
| T |
7334307 |
taccgactttggcttgttctgttgttattttgcaagatgatttctctgagcatactcggcaggcggcatgtcttaatctttccatttccctttagtgcca |
7334208 |
T |
|
| Q |
135 |
caacttgaatcatgctacggtctctcaactcttctaggtaactttctgcagtctcttcgggtgt |
198 |
Q |
| |
|
| |||||||||||| | | |||| ||||||||||||| ||||| |||||||| ||||| ||||| |
|
|
| T |
7334207 |
ctacttgaatcatgttgctgtctatcaactcttctagataactctctgcagtgtcttcaggtgt |
7334144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University