View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18946_low_3 (Length: 506)

Name: NF18946_low_3
Description: NF18946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18946_low_3
NF18946_low_3
[»] chr4 (62 HSPs)
chr4 (19-388)||(17946386-17946755)
chr4 (93-234)||(2559278-2559419)
chr4 (93-235)||(5472846-5472988)
chr4 (93-235)||(52950053-52950195)
chr4 (135-232)||(21429314-21429411)
chr4 (93-234)||(29895758-29895899)
chr4 (93-233)||(33647692-33647832)
chr4 (93-235)||(20128280-20128422)
chr4 (93-235)||(36145213-36145355)
chr4 (93-235)||(38075404-38075546)
chr4 (93-235)||(38165998-38166140)
chr4 (135-235)||(10541029-10541128)
chr4 (159-235)||(24166487-24166563)
chr4 (93-228)||(8888993-8889128)
chr4 (145-235)||(16450323-16450413)
chr4 (93-235)||(20421745-20421886)
chr4 (158-235)||(16645154-16645231)
chr4 (158-235)||(48015071-48015148)
chr4 (158-234)||(7246645-7246721)
chr4 (145-236)||(29588759-29588850)
chr4 (158-233)||(40780861-40780936)
chr4 (139-234)||(45721103-45721198)
chr4 (145-235)||(3159467-3159557)
chr4 (93-235)||(47078429-47078571)
chr4 (93-235)||(49260663-49260805)
chr4 (93-235)||(53599031-53599173)
chr4 (158-223)||(3507306-3507371)
chr4 (157-234)||(31588721-31588798)
chr4 (93-181)||(1446797-1446885)
chr4 (96-224)||(40272340-40272468)
chr4 (93-235)||(3574446-3574586)
chr4 (159-234)||(14124053-14124128)
chr4 (95-234)||(15829672-15829811)
chr4 (464-499)||(17946831-17946866)
chr4 (93-235)||(6779182-6779324)
chr4 (161-235)||(21192679-21192753)
chr4 (93-235)||(38168228-38168369)
chr4 (159-225)||(46108728-46108794)
chr4 (161-235)||(48834698-48834772)
chr4 (159-232)||(295534-295607)
chr4 (158-235)||(14858746-14858823)
chr4 (158-235)||(15732446-15732523)
chr4 (158-235)||(17080079-17080156)
chr4 (158-235)||(36262765-36262842)
chr4 (93-198)||(55005341-55005446)
chr4 (145-233)||(7741948-7742036)
chr4 (159-235)||(14597898-14597974)
chr4 (133-233)||(14859302-14859402)
chr4 (163-235)||(35359777-35359849)
chr4 (158-234)||(42722576-42722652)
chr4 (158-234)||(43458649-43458725)
chr4 (159-235)||(47682380-47682456)
chr4 (159-234)||(14567276-14567351)
chr4 (163-234)||(37369041-37369112)
chr4 (193-235)||(4738689-4738731)
chr4 (159-233)||(13073575-13073649)
chr4 (145-235)||(18531542-18531632)
chr4 (166-231)||(1940779-1940844)
chr4 (125-234)||(2686454-2686563)
chr4 (158-222)||(20532420-20532484)
chr4 (93-181)||(24850679-24850766)
chr4 (93-236)||(38841365-38841505)
[»] chr5 (44 HSPs)
chr5 (93-235)||(8513486-8513628)
chr5 (93-235)||(13664227-13664369)
chr5 (93-235)||(38897717-38897858)
chr5 (93-233)||(20525805-20525945)
chr5 (93-235)||(12766098-12766240)
chr5 (93-235)||(42086294-42086436)
chr5 (93-234)||(14588616-14588757)
chr5 (135-235)||(4016253-4016353)
chr5 (147-235)||(20228738-20228826)
chr5 (158-233)||(42291505-42291580)
chr5 (93-235)||(1538398-1538540)
chr5 (93-235)||(5731918-5732060)
chr5 (145-235)||(9805023-9805113)
chr5 (158-235)||(3653912-3653989)
chr5 (134-235)||(40117423-40117524)
chr5 (158-235)||(43399160-43399237)
chr5 (93-233)||(37263208-37263347)
chr5 (99-225)||(15034048-15034174)
chr5 (93-235)||(19572691-19572833)
chr5 (148-234)||(20692955-20693041)
chr5 (93-235)||(30349546-30349688)
chr5 (170-235)||(7616964-7617029)
chr5 (158-235)||(20255401-20255478)
chr5 (158-235)||(20590031-20590108)
chr5 (147-235)||(42861216-42861304)
chr5 (145-236)||(23383676-23383767)
chr5 (145-235)||(20682615-20682705)
chr5 (145-235)||(22655156-22655245)
chr5 (145-235)||(39099777-39099867)
chr5 (158-235)||(14728115-14728192)
chr5 (93-198)||(30995088-30995193)
chr5 (135-235)||(12081917-12082017)
chr5 (139-235)||(18262616-18262712)
chr5 (163-235)||(21375388-21375460)
chr5 (135-210)||(35813021-35813096)
chr5 (168-235)||(40773315-40773382)
chr5 (93-175)||(1898968-1899050)
chr5 (93-235)||(9812839-9812981)
chr5 (124-234)||(21149732-21149842)
chr5 (170-235)||(23247350-23247414)
chr5 (93-234)||(25417182-25417323)
chr5 (158-235)||(38369731-38369808)
chr5 (93-181)||(28857095-28857183)
chr5 (93-181)||(39728354-39728442)
[»] chr7 (43 HSPs)
chr7 (93-236)||(8734683-8734826)
chr7 (95-235)||(44961636-44961776)
chr7 (93-235)||(48804652-48804794)
chr7 (93-234)||(3353394-3353534)
chr7 (93-234)||(27028248-27028389)
chr7 (93-235)||(10047874-10048016)
chr7 (144-235)||(28744182-28744273)
chr7 (93-235)||(1797429-1797571)
chr7 (93-235)||(13095827-13095969)
chr7 (93-235)||(23658149-23658290)
chr7 (93-235)||(43861970-43862112)
chr7 (145-234)||(38578866-38578955)
chr7 (95-235)||(1605912-1606052)
chr7 (145-233)||(26423288-26423375)
chr7 (158-234)||(41945507-41945583)
chr7 (145-235)||(17748380-17748470)
chr7 (97-235)||(22973940-22974078)
chr7 (93-235)||(34659195-34659337)
chr7 (93-226)||(45447939-45448072)
chr7 (93-233)||(27875088-27875227)
chr7 (171-235)||(32768984-32769048)
chr7 (159-235)||(48551892-48551968)
chr7 (93-232)||(18785638-18785777)
chr7 (164-234)||(3603397-3603467)
chr7 (165-235)||(5069813-5069883)
chr7 (93-235)||(22993365-22993507)
chr7 (93-235)||(43346777-43346919)
chr7 (93-234)||(4705983-4706124)
chr7 (158-235)||(10317744-10317820)
chr7 (158-235)||(21190778-21190855)
chr7 (123-235)||(45697188-45697299)
chr7 (93-235)||(24969324-24969464)
chr7 (158-229)||(45960007-45960078)
chr7 (93-235)||(16802092-16802234)
chr7 (189-235)||(22268039-22268085)
chr7 (93-235)||(43925481-43925623)
chr7 (145-235)||(47341897-47341987)
chr7 (96-181)||(7774434-7774519)
chr7 (106-235)||(48244354-48244483)
chr7 (207-235)||(12422128-12422156)
chr7 (122-198)||(30827290-30827366)
chr7 (159-235)||(42210260-42210336)
chr7 (135-235)||(49142667-49142767)
[»] chr8 (29 HSPs)
chr8 (93-235)||(3418511-3418653)
chr8 (93-235)||(14666069-14666211)
chr8 (93-235)||(43032871-43033013)
chr8 (93-235)||(2467116-2467258)
chr8 (93-235)||(17981411-17981553)
chr8 (96-233)||(15884556-15884692)
chr8 (93-235)||(9859993-9860136)
chr8 (93-235)||(8141072-8141214)
chr8 (93-235)||(10927576-10927718)
chr8 (93-235)||(14846546-14846687)
chr8 (123-196)||(30903336-30903408)
chr8 (93-233)||(4479296-4479435)
chr8 (93-235)||(6100442-6100584)
chr8 (93-234)||(33401799-33401939)
chr8 (93-234)||(44893277-44893418)
chr8 (94-198)||(33935770-33935874)
chr8 (93-181)||(35496307-35496394)
chr8 (145-235)||(34710565-34710655)
chr8 (165-235)||(39969913-39969983)
chr8 (158-235)||(583847-583924)
chr8 (164-233)||(3379812-3379881)
chr8 (93-234)||(18373980-18374121)
chr8 (158-235)||(24837277-24837354)
chr8 (93-233)||(7673657-7673794)
chr8 (93-187)||(9395865-9395958)
chr8 (163-225)||(12754065-12754127)
chr8 (158-235)||(2964111-2964188)
chr8 (162-235)||(8997542-8997615)
chr8 (158-234)||(23895603-23895679)
[»] chr6 (26 HSPs)
chr6 (93-235)||(13036002-13036144)
chr6 (101-235)||(12635792-12635926)
chr6 (135-235)||(3601096-3601196)
chr6 (93-235)||(6606095-6606237)
chr6 (94-235)||(19089469-19089610)
chr6 (93-235)||(5253221-5253363)
chr6 (95-181)||(9366475-9366561)
chr6 (93-235)||(12606400-12606542)
chr6 (93-235)||(13468903-13469045)
chr6 (93-235)||(21898618-21898760)
chr6 (93-235)||(29444763-29444905)
chr6 (93-235)||(34954617-34954759)
chr6 (158-235)||(9633623-9633700)
chr6 (93-224)||(8888852-8888983)
chr6 (93-235)||(30788851-30788991)
chr6 (163-233)||(11142643-11142713)
chr6 (158-235)||(31129212-31129289)
chr6 (93-235)||(8932631-8932773)
chr6 (93-235)||(8944097-8944239)
chr6 (93-234)||(24671865-24672006)
chr6 (96-233)||(32157167-32157304)
chr6 (94-236)||(10311466-10311608)
chr6 (93-234)||(29333138-29333278)
chr6 (159-235)||(14783418-14783494)
chr6 (93-234)||(9179735-9179876)
chr6 (133-198)||(13391297-13391361)
[»] chr2 (53 HSPs)
chr2 (93-235)||(25540402-25540544)
chr2 (93-235)||(14853364-14853507)
chr2 (93-235)||(8410097-8410239)
chr2 (95-234)||(12864192-12864331)
chr2 (93-235)||(38005368-38005510)
chr2 (96-234)||(38962732-38962870)
chr2 (93-234)||(6358150-6358291)
chr2 (93-229)||(7787022-7787158)
chr2 (96-235)||(15234059-15234198)
chr2 (159-234)||(39806884-39806959)
chr2 (93-235)||(7747240-7747382)
chr2 (145-235)||(16325613-16325703)
chr2 (97-235)||(44139454-44139592)
chr2 (158-235)||(10823091-10823168)
chr2 (93-234)||(18649025-18649166)
chr2 (135-235)||(12455318-12455418)
chr2 (95-235)||(34346285-34346425)
chr2 (93-236)||(41031903-41032045)
chr2 (92-234)||(9360747-9360889)
chr2 (93-235)||(13026409-13026551)
chr2 (93-235)||(18902528-18902670)
chr2 (93-235)||(41220601-41220743)
chr2 (165-235)||(44945631-44945701)
chr2 (93-234)||(2550834-2550975)
chr2 (94-235)||(29422182-29422323)
chr2 (159-235)||(22593166-22593241)
chr2 (135-235)||(28616377-28616477)
chr2 (93-228)||(39201513-39201648)
chr2 (94-233)||(2784900-2785038)
chr2 (96-235)||(3643885-3644024)
chr2 (158-229)||(10669623-10669694)
chr2 (151-234)||(27725964-27726047)
chr2 (96-234)||(3848913-3849051)
chr2 (93-233)||(20612534-20612676)
chr2 (93-235)||(25549694-25549836)
chr2 (93-234)||(19976806-19976947)
chr2 (146-235)||(28525453-28525542)
chr2 (93-181)||(21286410-21286498)
chr2 (158-234)||(35946769-35946845)
chr2 (160-235)||(20116610-20116685)
chr2 (124-231)||(31740763-31740870)
chr2 (93-180)||(34356172-34356259)
chr2 (97-235)||(11069848-11069986)
chr2 (145-235)||(42770649-42770739)
chr2 (158-235)||(34722711-34722788)
chr2 (190-235)||(44548722-44548767)
chr2 (159-223)||(10026626-10026690)
chr2 (158-234)||(14169608-14169684)
chr2 (159-235)||(26805328-26805404)
chr2 (158-234)||(33005782-33005858)
chr2 (159-235)||(37560205-37560281)
chr2 (93-181)||(41187815-41187903)
chr2 (93-181)||(45263719-45263807)
[»] chr1 (51 HSPs)
chr1 (105-234)||(16263524-16263653)
chr1 (93-234)||(2567243-2567384)
chr1 (97-234)||(33004015-33004152)
chr1 (93-236)||(12036741-12036885)
chr1 (93-235)||(8763958-8764100)
chr1 (99-234)||(18649352-18649487)
chr1 (93-236)||(45361880-45362023)
chr1 (93-235)||(10422755-10422897)
chr1 (145-235)||(17642003-17642093)
chr1 (93-235)||(26325779-26325921)
chr1 (145-235)||(43959820-43959910)
chr1 (93-235)||(49078081-49078223)
chr1 (158-235)||(4581681-4581758)
chr1 (93-235)||(11397888-11398029)
chr1 (93-235)||(30927726-30927868)
chr1 (93-235)||(41663855-41663997)
chr1 (135-225)||(42710147-42710237)
chr1 (158-235)||(34719808-34719885)
chr1 (93-234)||(50371834-50371975)
chr1 (135-231)||(17092480-17092576)
chr1 (93-213)||(31152683-31152803)
chr1 (93-236)||(5855489-5855632)
chr1 (93-235)||(2980930-2981072)
chr1 (165-235)||(6899597-6899667)
chr1 (93-235)||(9853276-9853418)
chr1 (93-235)||(15238105-15238247)
chr1 (101-235)||(15465940-15466074)
chr1 (93-235)||(34697302-34697444)
chr1 (93-195)||(34877957-34878059)
chr1 (97-235)||(50503360-50503498)
chr1 (93-234)||(5503998-5504139)
chr1 (158-235)||(37339852-37339929)
chr1 (158-235)||(46929737-46929814)
chr1 (93-225)||(10336483-10336615)
chr1 (93-224)||(33418125-33418256)
chr1 (118-235)||(35908749-35908865)
chr1 (93-235)||(18915834-18915976)
chr1 (93-235)||(33498838-33498980)
chr1 (158-235)||(10172970-10173047)
chr1 (102-181)||(12744576-12744655)
chr1 (102-181)||(12755566-12755645)
chr1 (135-198)||(18708576-18708639)
chr1 (165-235)||(9659178-9659248)
chr1 (93-235)||(16956433-16956575)
chr1 (93-235)||(17389739-17389880)
chr1 (158-235)||(25178575-25178652)
chr1 (93-198)||(40226278-40226383)
chr1 (158-235)||(44969696-44969773)
chr1 (158-234)||(21849205-21849281)
chr1 (135-235)||(32142845-32142945)
chr1 (93-181)||(48798123-48798211)
[»] chr3 (52 HSPs)
chr3 (93-235)||(3136693-3136834)
chr3 (94-235)||(26923260-26923401)
chr3 (93-235)||(928566-928708)
chr3 (93-235)||(7650193-7650335)
chr3 (93-235)||(13893892-13894034)
chr3 (93-235)||(48341986-48342128)
chr3 (93-234)||(30767247-30767388)
chr3 (93-234)||(54261192-54261333)
chr3 (93-235)||(15320152-15320294)
chr3 (93-235)||(25294926-25295068)
chr3 (93-235)||(29127885-29128027)
chr3 (93-235)||(31072844-31072986)
chr3 (93-234)||(29762155-29762296)
chr3 (93-234)||(45877420-45877561)
chr3 (99-235)||(47219116-47219252)
chr3 (99-235)||(47749104-47749239)
chr3 (145-235)||(28572210-28572300)
chr3 (93-235)||(29135879-29136021)
chr3 (93-187)||(46529917-46530011)
chr3 (93-234)||(47471798-47471938)
chr3 (93-233)||(6462378-6462518)
chr3 (145-229)||(50405608-50405692)
chr3 (158-233)||(3507534-3507609)
chr3 (100-235)||(51060280-51060415)
chr3 (93-235)||(30045787-30045929)
chr3 (158-235)||(8164584-8164661)
chr3 (93-230)||(10040523-10040659)
chr3 (145-234)||(35315974-35316063)
chr3 (93-229)||(35923628-35923764)
chr3 (163-235)||(49021202-49021274)
chr3 (97-233)||(51682955-51683091)
chr3 (97-233)||(53649697-53649833)
chr3 (93-232)||(4638120-4638259)
chr3 (131-234)||(19146965-19147068)
chr3 (151-234)||(45450447-45450530)
chr3 (145-235)||(34374441-34374531)
chr3 (135-225)||(49198359-49198449)
chr3 (159-232)||(8362609-8362682)
chr3 (93-198)||(11687145-11687250)
chr3 (163-235)||(23511603-23511675)
chr3 (147-235)||(24506647-24506735)
chr3 (135-235)||(26590265-26590365)
chr3 (147-235)||(43330731-43330819)
chr3 (145-236)||(7328862-7328952)
chr3 (165-235)||(15285732-15285802)
chr3 (93-231)||(26207804-26207942)
chr3 (93-235)||(49543485-49543627)
chr3 (158-235)||(41630511-41630588)
chr3 (93-181)||(10855350-10855438)
chr3 (159-235)||(15084944-15085020)
chr3 (147-235)||(35998570-35998658)
chr3 (159-235)||(55069678-55069754)
[»] scaffold0170 (1 HSPs)
scaffold0170 (95-224)||(9816-9945)
[»] scaffold0009 (1 HSPs)
scaffold0009 (93-234)||(42831-42972)
[»] scaffold0002 (2 HSPs)
scaffold0002 (93-235)||(319391-319533)
scaffold0002 (93-235)||(539-681)
[»] scaffold0316 (1 HSPs)
scaffold0316 (93-235)||(1612-1754)
[»] scaffold0291 (1 HSPs)
scaffold0291 (145-235)||(6876-6966)
[»] scaffold0010 (1 HSPs)
scaffold0010 (145-235)||(155709-155799)
[»] scaffold0004 (2 HSPs)
scaffold0004 (158-235)||(7833-7910)
scaffold0004 (93-235)||(94978-95119)
[»] scaffold0041 (1 HSPs)
scaffold0041 (159-234)||(25120-25195)
[»] scaffold0016 (1 HSPs)
scaffold0016 (145-236)||(8698-8789)
[»] scaffold0223 (1 HSPs)
scaffold0223 (96-234)||(16851-16989)
[»] scaffold0209 (1 HSPs)
scaffold0209 (158-235)||(12607-12684)
[»] scaffold0116 (1 HSPs)
scaffold0116 (133-225)||(17399-17491)
[»] scaffold0005 (2 HSPs)
scaffold0005 (159-235)||(219404-219480)
scaffold0005 (159-234)||(250024-250099)
[»] scaffold0086 (1 HSPs)
scaffold0086 (135-234)||(26194-26293)
[»] scaffold0029 (1 HSPs)
scaffold0029 (93-235)||(41013-41155)
[»] scaffold0011 (1 HSPs)
scaffold0011 (164-234)||(224357-224427)
[»] scaffold0001 (1 HSPs)
scaffold0001 (158-236)||(65149-65227)
[»] scaffold0006 (1 HSPs)
scaffold0006 (166-231)||(68556-68621)
[»] scaffold0376 (1 HSPs)
scaffold0376 (158-234)||(12704-12780)


Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 62)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 388
Target Start/End: Original strand, 17946386 - 17946755
Alignment:
19 atttcaaccaataaatttcctt--ctgtctcatctatagtttgataaatatattagttatgtaaccaaattgtttgggcaaggagctcctttcaaggatg 116  Q
    ||||||||||||||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||  |||||||    
17946386 atttcaaccaataaatttccttttctgtctcacctatagtttgataaatatattagttatgtaaccaaattgtttgggcaag-agctccttcgaaggatg 17946484  T
117 tatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggat 216  Q
    ||| | ||||||| ||||||||||||| ||||||| ||||||||| ||||||||||||| ||||||||  |||||||||||||||||||||||||||  |    
17946485 tatatggggaatagcagattcgattttcaggggaa-caattcttgaccagtgcgcatgcttctacacatgagtcagattagttgtccacttttggtgagt 17946583  T
217 cggaaaccggtgcgaaagctnnnnnnntaaataaatatattactatgtgcatgacatgctttgctttttcttcattgagtaaggttatggtgtaaattaa 316  Q
    || |||||| ||||||||||       |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
17946584 cgaaaaccgttgcgaaagctaaaaaaataaataaatatattactatgtgcatggcatgctttgctttttcttcattgagtaaggttatggtgtaaattaa 17946683  T
317 ttagctcacttttcttttcatggtcacatttgcatttcttctaataatgaatatcacttttattcttcctct 388  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
17946684 ttagctcacttttcttttcatggtcacatttgcatttcttctaataatgaatatcacttttatgcttcctct 17946755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 2559278 - 2559419
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| |||||| ||| || ||||||| | |||||||||| |||| | |||||  |||||||||||||||||||||||| |||||| | |    
2559278 ggcaacgagctccttccaaggacgtacctggggaataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccgg 2559377  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||| | |||||| |||||||| |||||||||||||||||||    
2559378 attactcgtccacctttggtgggtcggaaaccggtgcgaaag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 5472988 - 5472846
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| ||||||||| |||||  ||||||| ||| || |||| | |||||||||||  |||||||||||||||||||||||| ||| || | |    
5472988 ggcaaggagctcatttcaaggacgtatccggggaataccaggtttgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccgg 5472889  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||| |||| |||||||||||    
5472888 attagtcgcccacctttggtgggtcgaaaactggtgcgaaagc 5472846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 52950053 - 52950195
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| || ||||||| | | |||||||   ||||| |||||  ||||||||||||||||| |||||||||  |  |||    
52950053 ggcaaggagctccttccaaggacgtacctggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccag 52950152  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| |||||||||| |||||||||    
52950153 attagtcgtccacctttggtgggtcggaaaccgatgcgaaagc 52950195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 135 - 232
Target Start/End: Original strand, 21429314 - 21429411
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    ||||||||||||||| |||||   || |||||||||||||||||||| ||| ||||||| |||| |||||| |||||||| |||||||||||||||||    
21429314 ttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcgaa 21429411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 29895758 - 29895899
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
29895758 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 29895857  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| ||||||  ||||||| |||||||||||||||||||    
29895858 attagtcgtccaccattggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 33647692 - 33647832
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| |||||| ||||||| | | ||||||||  ||||  |||||  |||| ||||||| ||| ||||||| ||| |  |||    
33647692 ggcaaggagctcctttcaaggacgtatctggggaataccgggttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccag 33647791  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| || ||  |||||||||||||||||||||||||||    
33647792 attagtcgttcatctttggtggatcggaaaccggtgcgaaa 33647832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 20128280 - 20128422
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||||| |||||  |||||||   | ||||||| | ||||| |||||| |||||||||||||||||||| ||| ||| ||  ||    
20128280 ggcaaggagttccttccaaggacgtatccggggaatactgggttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctag 20128379  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| || |||||||||||||||||    
20128380 attagtcgtccaccattggtgggtcagaaaccggtgcgaaagc 20128422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 36145355 - 36145213
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| ||| |  ||||||| | | |||||||   |||||||||||  ||||  |||||||||||||||||||||  || | |    
36145355 ggcaaggagctcattccaaggacgtacccggggaataccgggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccgg 36145256  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||| || |||||||||||||||||||||    
36145255 attagtcgtccacctttgatgaatcggaaaccggtgcgaaagc 36145213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 38075404 - 38075546
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||||| ||||   | ||||| | | ||||||| | |||||||||||  |||||||||||||||||||||||| ||  || |      
38075404 ggcaaggagttccttccaaggacgtattcggagaataccgggttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccga 38075503  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |||||||| |||||||| |||||||||| |||||||||    
38075504 attaattgtccacctttggtgggtcggaaaccgatgcgaaagc 38075546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 38165998 - 38166140
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  |||||||   | || ||||   ||||| |||||  ||||||||||||||||| |||||| ||| || | |    
38165998 ggcaaggagctccttccaaggacgtatccggggaatactgggttggattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccgg 38166097  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||||||||||||||||||||    
38166098 attagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 38166140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 135 - 235
Target Start/End: Original strand, 10541029 - 10541128
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||  |||||||||||  ||||||||||| |||||||||||| ||| || ||||||| | | |||| |||| |||||||||||||||||||||||    
10541029 ttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaaccggtgcgaaag 10541127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 24166487 - 24166563
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||||| ||| || |||||||||   |||| |||| ||||||||||||||||||||||||    
24166487 ttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaaagc 24166563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 93 - 228
Target Start/End: Original strand, 8888993 - 8889128
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||  ||||| |||||  ||||||| | | |||||||  |||||| |||||  ||||| ||||||||||| |||||| ||  || | |    
8888993 ggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccgg 8889092  T
193 attagttgtccacttttggtggatcggaaaccggtg 228  Q
    |||||| |||||| |||||||| |||||||||||||    
8889093 attagtcgtccacctttggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 16450323 - 16450413
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||| ||||||||||| ||  || ||||||||| |||||| |||||| | ||||||||||||||||||||    
16450323 agggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaagc 16450413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 20421745 - 20421886
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||||||| || |||||| ||||||| | | ||||||||  ||||| |||||  |||||||||||||||||||||||| ||  || |||    
20421745 ggcaaggagctcctttcaaagacgtatctggggaata-ctggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccag 20421843  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |||||   ||| ||| ||||||||| || |||||||    
20421844 attaatcgtccatcattgatgggtcggaaaccagttcgaaagc 20421886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 16645154 - 16645231
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| |||||||||||||||  |||| ||||||| | |||| | |||||| ||||||||||||||||||||    
16645154 cttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaagc 16645231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 48015148 - 48015071
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||| |||||||| ||| || | ||||||| | ||| ||||| ||||||||||||||||||||||||    
48015148 cttggccagtgcgcaagcctctacgcacgagccggattagtagcccaattttgatggatcggaaaccggtgcgaaagc 48015071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 158 - 234
Target Start/End: Complemental strand, 7246721 - 7246645
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||||||||| ||  || | ||||||| | |||| |||||||| |||||||||||||||||||    
7246721 cttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 145 - 236
Target Start/End: Original strand, 29588759 - 29588850
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    |||||||||||  |||||| ||||||||||||||||| ||| || | |||||||| |||||  ||||||| ||||||| || ||||||||||    
29588759 aggggaaacaaagcttggctagtgcgcatgcctctacgcacgagccggattagttatccaccattggtgggtcggaaatcgatgcgaaagct 29588850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 233
Target Start/End: Complemental strand, 40780936 - 40780861
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||| |||||||||||||||||| ||  || | ||||||| |||||| |||||||| ||||||||||||||||||    
40780936 cttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 40780861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 234
Target Start/End: Original strand, 45721103 - 45721198
Alignment:
139 atttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||| |||||||| |||  ||||||| ||||| ||||||||| |||||||| ||||||| |||||| |||  ||| | |||||||||||||||||    
45721103 attttcaggggaaataatgtttggccactgcgcgtgcctctacgcacaagtcggattagtcgtccacctttaatgggttggaaaccggtgcgaaag 45721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 3159557 - 3159467
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||| || ||||||||| |  |||  ||||||| |||||||||||||| |||||    
3159557 agggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc 3159467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 47078429 - 47078571
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||||| |||||  |||||||||||| ||||||||||| ||| || | |    
47078429 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccgg 47078528  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  |||  ||||||| ||||||||| ||||||||||    
47078529 attagtcgctcaccattggtgggtcggaaaccagtgcgaaagc 47078571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 49260805 - 49260663
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||| |||||| ||||||||||||  |||||||    |||| |||   | ||| |||||  |||||||||||||||||||||||| ||| || | |    
49260805 ggcaaggaactccttccaaggatgtatccggggaatactgaattcaattcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccgg 49260706  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||||||| |||||| |||||    
49260705 attagtcgaccacctttggtgggtcggaaatcggtgcaaaagc 49260663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 53599031 - 53599173
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||| | |||||   ||||||||||||||||||||||| ||  || | |    
53599031 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccgg 53599130  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | || ||| ||| |||||||||||||||||||||||||    
53599131 attaatcgttcacctttagtggatcggaaaccggtgcgaaagc 53599173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 223
Target Start/End: Original strand, 3507306 - 3507371
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaac 223  Q
    |||||| ||||||| ||||||||||||| || | ||||||| |||||| |||||||||||||||||    
3507306 cttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggatcggaaac 3507371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 31588721 - 31588798
Alignment:
157 tcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||| |||||| ||  || | ||||||| |  ||||||||||||||||||||||| ||||||||    
31588721 tcttggccagtgcgcatgtctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 1446797 - 1446885
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||||| |||||  ||||||||||||||||||||||||    
1446797 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctac 1446885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 96 - 224
Target Start/End: Complemental strand, 40272468 - 40272340
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    ||||||||| || ||| ||||||||  ||||||| | | ||||||||  | ||| |||||  |||||||||||||||||||||||| || ||||| ||||    
40272468 aaggagctctttccaatgatgtatccggggaatatcgggttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatt 40272369  T
196 agttgtccacttttggtggatcggaaacc 224  Q
     || || |||  ||||||| |||||||||    
40272368 tgtcgttcaccattggtgggtcggaaacc 40272340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 3574586 - 3574446
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |||||||||| |   ||| |||   ||||  |||||  |||||||||||||||||||||||| ||| |||| |    
3574586 ggcaaggagctccttccaaggacgtacctagggaataccgagttcaattcccagggagaacaacacttggccagtgcgcatgcctctacgcacgagtcgg 3574487  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||| || ||||  ||||||||||||| ||||||    
3574486 attagtcgctcaccttaggtg--tcggaaaccggtgagaaagc 3574446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 159 - 234
Target Start/End: Original strand, 14124053 - 14124128
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||||||||||||||||||| || | ||||||| |  |||  ||||||| | |||||||||||||||||    
14124053 ttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaag 14124128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 95 - 234
Target Start/End: Original strand, 15829672 - 15829811
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    ||||||||| |||||||||| |||||  | ||||| |   || |||||| ||||||| |||  |||||||||||||||||| ||||  ||  || | |||    
15829672 caaggagcttctttcaaggacgtatccggagaatatccagtttgattttcaggggaatcaacacttggccagtgcgcatgcttctaggcatgagccggat 15829771  T
195 tagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||  |||||  |||||||||| ||||||||||||||||    
15829772 tagtcctccaccattggtggatcagaaaccggtgcgaaag 15829811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 464 - 499
Target Start/End: Original strand, 17946831 - 17946866
Alignment:
464 cccctcactcaacttggagatttcttacctatgctt 499  Q
    ||||||||||||||||||||||||||||||||||||    
17946831 cccctcactcaacttggagatttcttacctatgctt 17946866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 6779182 - 6779324
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| ||| |||||| ||| || | ||||| | | |||||||   ||||| |||||  | |||||||||||||||||||||  ||  || | |    
6779182 ggcaaggagcttcttccaaggacgtacctggagaataccgggttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccgg 6779281  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| ||||||| ||||||| ||| |||||||||    
6779282 attagtcgtccacctttggtgaatcggaacccgatgcgaaagc 6779324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 161 - 235
Target Start/End: Original strand, 21192679 - 21192753
Alignment:
161 ggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||| ||| |||| ||||| | | |||| |||||||  ||| ||||||||||||||||    
21192679 ggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccggtgcgaaagc 21192753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 38168228 - 38168369
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| ||| |||||||  || | | |||||  |||||||||||| ||||||||||| ||  || | |    
38168228 ggcaaggagctccttccaaggacgtacccggggaataccaggttcgattcctaagaggaacaacgcttggccagtgc-catgcctctacgcatgagccgg 38168326  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| | ||||||||||||||||||    
38168327 attagtcgttcacctttagtgggttggaaaccggtgcgaaagc 38168369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 159 - 225
Target Start/End: Original strand, 46108728 - 46108794
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccg 225  Q
    ||||| ||||||||||||||||| ||  || ||||||||| ||||||||||| ||| ||||||||||    
46108728 ttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccg 46108794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 161 - 235
Target Start/End: Complemental strand, 48834772 - 48834698
Alignment:
161 ggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||| |||||||||| |||  |||| ||||||| | | || |||||||| ||||||||||||||||||||    
48834772 ggccagtgcacatgcctctatacatgagtcggattagtcgcctacctttggtgggtcggaaaccggtgcgaaagc 48834698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 232
Target Start/End: Complemental strand, 295607 - 295534
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    ||||||||||||||||||||||| ||| |  ||||||||| ||||||  ||||||| |  ||||||||||||||    
295607 ttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttggtgggtttgaaaccggtgcgaa 295534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 14858746 - 14858823
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |||||||||||| ||||||  || |||||||||| | |||||| |||| ||| || |||||||||||||||||    
14858746 cttgaccagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaaagc 14858823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 15732523 - 15732446
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||| ||||||||||| |||  |  |||||||| |  ||  |||||||||||||||||||||||||||||    
15732523 cttggccagtgcacatgcctctacgcacgggctagattagtcgctcatctttggtggatcggaaaccggtgcgaaagc 15732446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 17080079 - 17080156
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||  || | ||||||| |  ||| |||| ||||||| ||||||||||||||||    
17080079 cttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc 17080156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 36262842 - 36262765
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||| ||||||||||| ||| |||| ||||||| | |||| |||||||| || ||||||  |||||||||    
36262842 cttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagc 36262765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 198
Target Start/End: Complemental strand, 55005446 - 55005341
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| ||| || |||||| || |||| |  ||||||||   |||||||||||  |||| ||| ||||||||||||||| |||||||| |    
55005446 ggcaatgagctccttccaaagacgtatctgggaaataccgaattcgattcgcaggggaaacaacgcttgaccattgcgcatgcctctacgcacaagtcgg 55005347  T
193 attagt 198  Q
    ||||||    
55005346 attagt 55005341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 145 - 233
Target Start/End: Original strand, 7741948 - 7742036
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||| |||||  |||||||||||| ||||||||||| ||| |  ||||||||| |||||  ||||||| |||| |||| |||||||||    
7741948 aggggtaacaacgcttggccagtgcacatgcctctacgcacgatccagattagtcgtccatctttggtgaatcgaaaactggtgcgaaa 7742036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 14597974 - 14597898
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||||| ||| |    ||||||| |||||| |||| ||||||| |||||||||| |||||    
14597974 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 14597898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 133 - 233
Target Start/End: Original strand, 14859302 - 14859402
Alignment:
133 gattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    ||||||||||| ||| | ||||||  ||| |||||||||||| |||||| ||| || |||||||||  ||||| |||| ||  |||||||| ||||||||    
14859302 gattcgattttcaggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaa 14859401  T
233 a 233  Q
    |    
14859402 a 14859402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 163 - 235
Target Start/End: Original strand, 35359777 - 35359849
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||| || || ||||  ||||||| | ||||| | ||||| ||||||||||||||||||||    
35359777 ccagtgcgcatgcctcaacgcataagttggattagtcgcccactataggtgggtcggaaaccggtgcgaaagc 35359849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 158 - 234
Target Start/End: Complemental strand, 42722652 - 42722576
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||||||||| ||  || | ||||||| || ||| ||| |||| ||| |||||||||||||||    
42722652 cttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 43458649 - 43458725
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||||||||||||||||  || || | ||||||| |||||| |||| ||  |||||||||| ||||||||    
43458649 cttggccagtgcgcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaag 43458725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 47682456 - 47682380
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| |||| |||||| ||| || | | ||||| | |||| |||||||| ||||||||||||||||||||    
47682456 ttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 47682380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 159 - 234
Target Start/End: Original strand, 14567276 - 14567351
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||||||||||||||| ||| || | ||||||| |  | | |||||||| ||||||| |||||||||||    
14567276 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 14567351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 163 - 234
Target Start/End: Complemental strand, 37369112 - 37369041
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||||||||| ||| |||| ||| ||| | ||||| |||||| ||||||||||| ||||||||    
37369112 ccagtgtgcatgcctctacgcacgagtcggataagtcgcccactattggtgaatcggaaaccgatgcgaaag 37369041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 4738689 - 4738731
Alignment:
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| ||||||||||||||||||||    
4738689 attagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4738731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 159 - 233
Target Start/End: Original strand, 13073575 - 13073649
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||||||||||||| ||||||| ||  |  ||||||||| ||  || |||||||| ||||||||||||||||||    
13073575 ttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 18531542 - 18531632
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  ||||| ||||||||||||||| |  ||| |  ||||||| | |||||| ||| |||| ||||||||||||||||||||    
18531542 agggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaagc 18531632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 166 - 231
Target Start/End: Complemental strand, 1940844 - 1940779
Alignment:
166 gtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcga 231  Q
    |||||||||||||||| ||| || | ||||||| | |||| |||||||| ||| ||||||||||||    
1940844 gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 1940779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 234
Target Start/End: Complemental strand, 2686563 - 2686454
Alignment:
125 gaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaacc 224  Q
    ||||| ||||||||||||| |||||||||||  |||| ||| | |  ||| |||||||||  || |  |||||| |||||| ||| |||| | |||||||    
2686563 gaatatcagattcgattttcaggggaaacaacacttgaccactacatatgtctctacacatgagccgaattagtcgtccaccttttgtgggttggaaacc 2686464  T
225 ggtgcgaaag 234  Q
    ||||||||||    
2686463 ggtgcgaaag 2686454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 222
Target Start/End: Complemental strand, 20532484 - 20532420
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaa 222  Q
    |||||||||||||||||||||||| ||  || | ||| ||| | |||| ||||||||||||||||    
20532484 cttggccagtgcgcatgcctctacgcatgagccggataagtcgcccacctttggtggatcggaaa 20532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Complemental strand, 24850766 - 24850679
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||||||||| || |||||| |||||  || |||| ||||||| ||| | ||||||| |||  |||| |||||||||||||||||||    
24850766 ggcaaggagctcattccaaggacgtatccgggaaataccagattcaattatcaggggaa-caacacttgaccagtgcgcatgcctctac 24850679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 236
Target Start/End: Complemental strand, 38841505 - 38841365
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||| ||| |||||| ||| || ||||||| ||| |||||||||||||| ||||||  |||| | |||  ||||| |||||| ||  |||| |    
38841505 ggcaatgagcttcttccaaggacgta-ctcgggaataccaggttcgatttttagggaaaacaacgcttgtctagt--gcatgtctctacgcatgagtcgg 38841409  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    |||||| |||||  |||||| | ||||||| || ||||||||||    
38841408 attagtcgtccatctttggtagttcggaaatcgatgcgaaagct 38841365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 71; Significance: 6e-32; HSPs: 44)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8513486 - 8513628
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||  ||||||||||||| |||||||||||| ||||||||||| ||| || |||    
8513486 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccag 8513585  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| ||||||||||||||||||||    
8513586 attagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 8513628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 13664227 - 13664369
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||||||||||| | ||||||||| | ||||| |||||  |||||||||||||||||||||||| ||  || |||    
13664227 ggcaaggagctccttccaaggacgtatctagggaataccggattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccag 13664326  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |  ||| |||||||  ||||||||||||||||||||    
13664327 attaatcgatcacctttggtgtgtcggaaaccggtgcgaaagc 13664369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 38897858 - 38897717
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| |||| | ||||||| | | ||||||||  ||||||| |||  |||||||||||||||||||||||| ||| || | |    
38897858 ggcaaggagctctttacaaggacgtatatggggaataccgggttcgatttccaggggaa-caacgcttggccagtgcgcatgcctctacgcacgagccgg 38897760  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||| |||| |||||||||||||||||| ||||||||||    
38897759 attagttgcccacctttggtggatcggaaaccagtgcgaaagc 38897717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 20525805 - 20525945
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||||||||||||||||  ||||||| | | |||||||   ||| | |||||  ||| |||||||||||||||||||| ||  || | |    
20525805 ggcaaggagctcctttcaaggatgtatccggggaatatcgggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccgg 20525904  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| ||||||  ||||||||||||||||||||||||||    
20525905 attagtcgtccaccattggtggatcggaaaccggtgcgaaa 20525945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 12766098 - 12766240
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | ||||||| | ||| | |||||| ||||||||||| |||||||||||| ||  |  |||    
12766098 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaaccag 12766197  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| || |||||||||||||||||    
12766198 attagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 12766240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 42086294 - 42086436
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |   |||||| | | |||||||   ||||| |||||  |||| ||||||||||||||||||| ||  || | |    
42086294 ggcaaggagctccttccaaggacgtacccgaggaataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccgg 42086393  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| ||||||||||||||||||||    
42086394 attagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 42086436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 14588757 - 14588616
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| |||||||||| |||||| ||||||| | | ||||||||| ||| | || ||  |||| ||||||||||||||||||| ||  || | |    
14588757 ggcaaggagcttctttcaaggacgtatctggggaatatcgggttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatgagccgg 14588658  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||||||   || |||||||||||||||    
14588657 attagtcgtccacctttggtgagccgaaaaccggtgcgaaag 14588616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 4016353 - 4016253
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||| | ||||| |||||  |||||||||||||||||||||||||||| || | |||||||||  |||  ||||||| ||||||||| |||||||||    
4016353 ttcgattatcagggggaacaacacttggccagtgcgcatgcctctacacacgagccggattagttgctcaccattggtgggtcggaaaccagtgcgaaag 4016254  T
235 c 235  Q
    |    
4016253 c 4016253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 147 - 235
Target Start/End: Original strand, 20228738 - 20228826
Alignment:
147 gggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||| |||||| |||||| |||||||||||||| |||||||||||| | |||  ||||||||||| ||||||| || ||||||    
20228738 gggaaacaatgcttggctagtgcgtatgcctctacacacgagtcagattagtcgcccatctttggtggatcagaaaccgatgtgaaagc 20228826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 158 - 233
Target Start/End: Complemental strand, 42291580 - 42291505
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||||||||| ||||||||||| ||| || | ||||||| |||||| |||| ||||||||||||||||||||||    
42291580 cttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa 42291505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 1538398 - 1538540
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| | |||| ||||   ||||||| | | |||||||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
1538398 ggcaaggagctccttccgaggacgtattcggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 1538497  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | ||||||  ||||||| ||||||||||||||||||||    
1538498 attaatcgtccaccattggtgggtcggaaaccggtgcgaaagc 1538540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 5732060 - 5731918
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||| | |||||  ||||||||||||||||||||||||  |  || |||    
5732060 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccag 5731961  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| ||||||||||||||||||||    
5731960 attagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 5731918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 9805023 - 9805113
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||  || | ||||||| |||||| |||||||| |||||||| |||||||||||    
9805023 agggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaagc 9805113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 3653989 - 3653912
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||| ||| || | ||||||| |||||| |||||||||||| |||||||||| |||||    
3653989 cttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgcaaaagc 3653912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 134 - 235
Target Start/End: Original strand, 40117423 - 40117524
Alignment:
134 attcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||||||  ||||| |||||  |||||||||||||||||||||||| ||  || | ||||| | || ||| |||||||||||| ||||||||||||||    
40117423 attcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaa 40117522  T
234 gc 235  Q
    ||    
40117523 gc 40117524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 43399160 - 43399237
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||| ||   ||||||| |||||| |||||| | ||||||||||||||||||||    
43399160 cttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc 43399237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 37263208 - 37263347
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| |||||  ||||| ||| |  ||||||| | | ||||||| | ||||||| |||  |||||||| ||||||||||||||| ||| || | |    
37263208 ggcaaggagttccttctaaggacgtacccggggaatatcgggttcgattctcaggggaa-caacgcttggccaatgcgcatgcctctacgcacgagccgg 37263306  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| |||||| |||  ||||||||||||||||||||||    
37263307 attagtcgtccacctttattggatcggaaaccggtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 99 - 225
Target Start/End: Original strand, 15034048 - 15034174
Alignment:
99 gagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    ||||||||| |||||||||| |  ||||||| | | ||| ||||  | |||||||||  ||||| ||||| |||||||||||| ||  || | |||||||    
15034048 gagctccttccaaggatgtacccggggaataccgggttcaatttccatgggaaacaacacttggtcagtgtgcatgcctctacgcatgagcctgattagt 15034147  T
199 tgtccacttttggtggatcggaaaccg 225  Q
    ||||||| |||| ||||||||||||||    
15034148 tgtccacctttgatggatcggaaaccg 15034174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 19572691 - 19572833
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | || ||||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
19572691 ggcaaggagctccttccaaggacgtatccggggaataccgggttagattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 19572790  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || |||  ||||||| | ||||||| ||||||||||    
19572791 attagtcgttcaccattggtgggttggaaaccagtgcgaaagc 19572833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 148 - 234
Target Start/End: Original strand, 20692955 - 20693041
Alignment:
148 ggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||  |||||||||| | |||||||||   ||  | ||||||||||||||||| |||||||| |||||||||||||||||||    
20692955 ggaaacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacctttggtgggtcggaaaccggtgcgaaag 20693041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 30349546 - 30349688
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||||| |||||  ||||||| | | || ||||| |||||| ||||||  ||||||||||||||||||||||  ||  ||        
30349546 ggcaaggagttccttccaaggacgtatccggggaataccgggtttgatttctagggggaacaatgattggccagtgcgcatgcctctatgcatgagctga 30349645  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| || |||||  |||||||||||||||||||    
30349646 attagtcgtccaccttaggtgggccggaaaccggtgcgaaagc 30349688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 170 - 235
Target Start/End: Original strand, 7616964 - 7617029
Alignment:
170 gcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||| ||  |||||||||||| ||||| | |||||||||||||||| |||||||||||    
7616964 gcatgcctctacgcatgagtcagattagtcgtccattattggtggatcggaaactggtgcgaaagc 7617029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 20255401 - 20255478
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||| ||  |||| ||||||| |||||| |||||||  |||||||| |||||||||||    
20255401 cttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc 20255478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 20590031 - 20590108
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||| |||||| ||  || |  |||||||||||||| |||| |||||||||||||||||| ||||    
20590031 cttggccagtgcgcatgactctacgcatgagccgtattagttgtccactattggaggatcggaaaccggtgcggaagc 20590108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 147 - 235
Target Start/End: Complemental strand, 42861304 - 42861216
Alignment:
147 gggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||  |||||||||||||||||||||||| ||  || | ||||| | ||||||  ||||||| ||||| ||||||||||||||    
42861304 gggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaagc 42861216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 145 - 236
Target Start/End: Original strand, 23383676 - 23383767
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||| |||||  |||||||||||||| ||||||||| ||  ||   ||||||| |||||| |||||||| |||||||| ||||||||||||    
23383676 agggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagct 23383767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 20682705 - 20682615
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||| || | ||||| | | |||| ||| |||| | ||||||||||||||||||    
20682705 agggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaagc 20682615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 22655245 - 22655156
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||  |||  ||||| |||||||||||| || ||||||||||||| |||||| ||| |||| ||| ||||| ||||||||||    
22655245 aggggaaacaatgtttgatcagtgtgcatgcctctacgcataagtcagattagtcgtccaccttt-gtgggtcgaaaaccagtgcgaaagc 22655156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 39099867 - 39099777
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||| ||||||||||| ||  || | ||||||| | |||| |||||||| |||||||||||||| |||||    
39099867 agggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagc 39099777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 14728115 - 14728192
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||||||||||||||| ||  || | |||||||||  ||| |||| ||| ||||||||||||||||||||    
14728115 cttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc 14728192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 198
Target Start/End: Original strand, 30995088 - 30995193
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||  | ||||||| ||| |||||||   ||||| |||||  ||||||||| |||||||||||||| ||| || | |    
30995088 ggcaaggagctccttccaaggacgtacatggggaataccaggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccgg 30995187  T
193 attagt 198  Q
    ||||||    
30995188 attagt 30995193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 135 - 235
Target Start/End: Original strand, 12081917 - 12082017
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||| | ||||| |||||  |||||||||||||||||| ||||| ||| || |  |||||| |||||| |||||||  ||||||| ||||| |||||    
12081917 ttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccacctttggtgagtcggaaatcggtgtgaaag 12082016  T
235 c 235  Q
    |    
12082017 c 12082017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 139 - 235
Target Start/End: Complemental strand, 18262712 - 18262616
Alignment:
139 atttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| ||||| |||||  |||| ||||||||||| ||||||||||| || | ||||||| | |||| | || ||||||| ||| ||||||||||||    
18262712 attttcagggggaacaacgcttgaccagtgcgcatacctctacacacgagccggattagtcgcccacctctgatggatcgaaaatcggtgcgaaagc 18262616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 163 - 235
Target Start/End: Original strand, 21375388 - 21375460
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||| ||||| ||  |||| ||||||| |||||  |||| ||||||||||||| ||||||||||    
21375388 ccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaaagc 21375460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 210
Target Start/End: Complemental strand, 35813096 - 35813021
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttg 210  Q
    |||||||  ||||||||| ||| |||| |||||||||||| |||||||||  |||| ||||||| |||||| ||||    
35813096 ttcgattcctaggggaaataatgcttgaccagtgcgcatgtctctacacatgagtcggattagtcgtccacctttg 35813021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 168 - 235
Target Start/End: Original strand, 40773315 - 40773382
Alignment:
168 gcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||| || |||| ||||||| || ||  |||||||  ||||||||||||||||||||    
40773315 gcgcatgcctctacatacgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaagc 40773382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 175
Target Start/End: Original strand, 1898968 - 1899050
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgc 175  Q
    ||||||||||||||| |||||||||| |  ||||||| | | |||||||   ||||| |||||  ||||||||||||||||||    
1898968 ggcaaggagctccttccaaggatgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgc 1899050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 9812839 - 9812981
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||| | |||||  ||||||||||| |||||| ||||| ||  |  | |    
9812839 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaaccgg 9812938  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| || |||||||||||||||||    
9812939 attagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 9812981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 124 - 234
Target Start/End: Original strand, 21149732 - 21149842
Alignment:
124 ggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaac 223  Q
    |||||| ||| ||||||||| ||||| |||||   ||| |||||||||||| |||||| ||| |||  ||||||| | ||||  ||||||||| | ||||    
21149732 ggaataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccattggtggatagaaaac 21149831  T
224 cggtgcgaaag 234  Q
    || ||||||||    
21149832 cgatgcgaaag 21149842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 170 - 235
Target Start/End: Complemental strand, 23247414 - 23247350
Alignment:
170 gcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||| ||| || ||||||||| |||||| |||| ||| ||| ||||||||||||||||    
23247414 gcatgcctctacgcacgagccagattagtcgtccacctttgatgg-tcgaaaaccggtgcgaaagc 23247350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 25417323 - 25417182
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||    ||||||| | | |||||||   ||||| |||||  ||||||||||||||||||||||||  || || | |    
25417323 ggcaaggagctccttccaaggacgtactcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccgg 25417224  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||  |  ||  ||||||| || ||||||||||||||||    
25417223 attagtcatttaccattggtgggtcagaaaccggtgcgaaag 25417182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 38369731 - 38369808
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||| |||| |||||||   |||| |||| ||| |  |||| ||||||||||||    
38369731 cttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttagaaatcggtgcgaaagc 38369808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 28857095 - 28857183
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| |||||| | | |  ||||||| | | |||||||   ||||| |||||  ||||||||||||||||||||||||    
28857095 ggcaaggagctccttccaaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctac 28857183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 39728354 - 39728442
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||||||||| || |||| | ||| |  ||||||| ||| ||||||| | || ||||||||  ||||||||||| ||||||||||||    
39728354 ggcaaggagctctttccaagaacgtacccggggaataccaggttcgattatcagaggaaacaacacttggccagtgtgcatgcctctac 39728442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 68; Significance: 4e-30; HSPs: 43)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 93 - 236
Target Start/End: Complemental strand, 8734826 - 8734683
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||||||  ||||| ||||||| ||| |||||||| | |||| |||||| ||||| ||||||||||||||| || ||| || |||    
8734826 ggcaaggagctccttccaaggacatatctcgggaatatcaggttcgatttcttgggggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccag 8734727  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    |||||| | |||| |||||||| |||||||||||||||||||||    
8734726 attagtcgcccacctttggtgggtcggaaaccggtgcgaaagct 8734683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 95 - 235
Target Start/End: Complemental strand, 44961776 - 44961636
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    |||||||||||||||||||| |||||   | |||| ||||||| |||||||||||  ||||| |||| ||||| |||||| ||||||  || ||||||||    
44961776 caaggagctcctttcaaggacgtatccgagaaatatcagattcaatttttaggggggacaatgcttgaccagtacgcatgtctctacgtacgagtcagat 44961677  T
195 tagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| ||| | |||| ||| ||||||||||||||||||||    
44961676 tagttatccgcctttgatgggtcggaaaccggtgcgaaagc 44961636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 48804652 - 48804794
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   | ||| |||||  |||||||||||||||||||||||| ||  || | |    
48804652 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 48804751  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| ||||||||||||||||||||    
48804752 attagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 48804794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 3353394 - 3353534
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| ||  ||||| |||||||||||||| | |  |||||| | |||| ||||||   ||||||||||||||||||||||| ||| || | |    
3353394 ggcaaggagctcattataaggacgtatctagggaatatcgggatcgattctcaggg-aaacaacatttggccagtgcgcatgcctctacgcacgagccgg 3353492  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||| |||||| ||||||||||||||||    
3353493 attagtcgtccacctttgatggatcagaaaccggtgcgaaag 3353534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 27028248 - 27028389
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||| | ||| || || |||| ||| ||||||||  ||||| |||||  |||||||||||||||||||||||||||  ||   |    
27028248 ggcaaggagctcattccaagaacgtacctgggaaataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctgg 27028347  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |  ||| |||||||| |||||||||||||||||||    
27028348 attagtcgctcacctttggtgggtcggaaaccggtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 10048016 - 10047874
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||||| |||||  ||||||||||||||| |||||||| ||  || |||    
10048016 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgag-cag 10047918  T
193 -attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
     |||||| ||||||  ||||||| ||||||||||||||||||||    
10047917 aattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 10047874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 144 - 235
Target Start/End: Original strand, 28744182 - 28744273
Alignment:
144 taggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||||| ||||| |||||||| || || | ||||||| |||||| |||||||| |||||||| |||||||||||    
28744182 tagggggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 28744273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 1797429 - 1797571
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||   |||||| | | |||||||   |||||||||||  ||||||||||||||||| |||||| ||| || | |    
1797429 ggcaaggagctccttccaaggacgtatccgaggaataccgggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccgg 1797528  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    | |||| |||||  |||| ||||||| |||||||||| |||||    
1797529 actagtcgtccatctttgatggatcgaaaaccggtgcaaaagc 1797571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 13095827 - 13095969
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| ||| |  ||||||| | | ||| |||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
13095827 ggcaaggagctcctttcaaggacgtacccggggaataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 13095926  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||| |||||||| |||||||||||||| |||||    
13095927 attagtcgctcacctttggtgggtcggaaaccggtgcaaaagc 13095969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 23658149 - 23658290
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| | |||||||| |   ||||||||  ||||| |||||  ||||||||||| |||||||||||||||| || | |    
23658149 ggcaaggagctcctt-caaggacgtacccagggaatatccagttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccgg 23658247  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||  |||||||| || |||||| |||| |||||    
23658248 attagtcgtccatctttggtgggtcagaaacctgtgcaaaagc 23658290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 43862112 - 43861970
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || ||| || |||||| ||||||| | | |||||||   ||||| |||||   ||||||||||||||||||||||| ||  || | |    
43862112 ggcaaggagctctttccaaagacgtatctggggaataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccgg 43862013  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||  | ||| |||||||||||| ||||||||||||||||    
43862012 attagtcattcacctttggtggatcgaaaaccggtgcgaaagc 43861970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 145 - 234
Target Start/End: Complemental strand, 38578955 - 38578866
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||| |||||  |||||||||||||||||||||||| ||  || | ||||||| | |||| |||||||| |||||||||||||||||||    
38578955 agggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 95 - 235
Target Start/End: Original strand, 1605912 - 1606052
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    ||||||||||||| |||||| ||| |  | ||||| | | ||||||||  ||||| |||||  |||||||||||| ||||||||||  |   || | |||    
1605912 caaggagctccttccaaggacgtacccggagaatacctggttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggat 1606011  T
195 tagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |||| |||||||||||||||||||||||||||||    
1606012 tagtcgcccacctttggtggatcggaaaccggtgcgaaagc 1606052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 145 - 233
Target Start/End: Complemental strand, 26423375 - 26423288
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||||||||  |||||||||||| | ||||||||| ||| || ||||||||| || ||| |||||||| ||||||||||||||||||    
26423375 aggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggtgg-tcggaaaccggtgcgaaa 26423288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 41945507 - 41945583
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||||||||| ||| || | ||||||| |||||| |||||||  ||||||| |||||||||||    
41945507 cttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag 41945583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 17748470 - 17748380
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  ||||||||||||||||||||||||  || || | ||||||| |||||| |||| ||| |||||||||| |||||||||    
17748470 agggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaagc 17748380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 235
Target Start/End: Original strand, 22973940 - 22974078
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    ||||||||||| |||||| |||    ||||||| | | ||||||| | ||||| |||||  ||||||||||| |||||| ||||| ||  || |||||||    
22973940 aggagctccttccaaggacgtactcggggaataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagatta 22974039  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || |||||| |||||||| || |||||||| ||||||||    
22974040 gtcgtccacctttggtgggtcagaaaccggcgcgaaagc 22974078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 34659195 - 34659337
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| || ||||||| |  ||||||| | | ||||||| | | ||| |||||  |||| ||||||||||||||||||| ||| || | |    
34659195 ggcaaggagctccttccagggatgtacccggggaataccgggttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccgg 34659294  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | ||||  ||||||  ||| ||||||||||||||||    
34659295 attagtcgcccaccattggtgtgtcgaaaaccggtgcgaaagc 34659337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 226
Target Start/End: Original strand, 45447939 - 45448072
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |   | |||| ||| ||||||||  ||||  |||||  |||||| ||||||||| ||||||||||| ||||||    
45447939 ggcaaggagctccttccaaggacgtacccgagaaataccaggttcgatttccagggagaacaacgcttggctagtgcgcatccctctacacactagtcag 45448038  T
193 attagttgtccacttttggtggatcggaaaccgg 226  Q
    ||||||   |||| ||| |||| |||||||||||    
45448039 attagtcacccacctttagtgggtcggaaaccgg 45448072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 27875227 - 27875088
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| |||||||| |||| | |||||| ||||||| | |||||||||   ||||| || ||  |||||||||||| ||||||||||| ||  ||||      
27875227 ggcaagtagctccttccaag-acgtatctggggaataccggattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgc 27875129  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| |||||| ||| |||| ||| ||||||||||||||    
27875128 attagtcgtccacctttagtgggtcgaaaaccggtgcgaaa 27875088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 32768984 - 32769048
Alignment:
171 catgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| ||| |||| ||||||| || ||| |||||||||||||||||||||| ||||||    
32768984 catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagc 32769048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 48551892 - 48551968
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||| |||||||||||||||  |  || | ||||||| |||||| |||| ||||||||||||||||||||||||    
48551892 ttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagc 48551968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 93 - 232
Target Start/End: Original strand, 18785638 - 18785777
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| |||||||| |||||| ||| |  ||||||| | | |||||||  |||||| |||||  |||||||||||||||||||||||| ||  |    |    
18785638 ggcaagaagctccttccaaggacgtacccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactgg 18785737  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    |||||| || ||| | |||||| |||||||||||||||||    
18785738 attagtcgttcacctctggtgggtcggaaaccggtgcgaa 18785777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 164 - 234
Target Start/End: Original strand, 3603397 - 3603467
Alignment:
164 cagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||| ||| || | ||||| | || |||||||||||| ||||||| |||||||||||    
3603397 cagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaag 3603467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 235
Target Start/End: Complemental strand, 5069883 - 5069813
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |||||||||||| |||||| | ||||||| | |||| |||||||| |||||||||| |||||||||    
5069883 agtgtgcatgcctctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc 5069813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 22993507 - 22993365
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||| | |||||  ||||||||||| |||||||||||| ||| |  | |    
22993507 ggcaaggagctccttccaaggacgtacccggggaatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccgg 22993408  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||| |||||||| || |||||||||||||||||    
22993407 attagtcgctcacctttggtgggtcagaaaccggtgcgaaagc 22993365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 43346919 - 43346777
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || |||||| ||||||| | | ||| ||| | | ||| |||||  ||||||| ||||||||||||||||  || || | |    
43346919 ggcaaggagctccttccaaagacgtatctggggaataccgggttcaattctcaaggggaacaacacttggccggtgcgcatgcctctacgtacgagccgg 43346820  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||  |||||||| ||||||||| ||||||||||    
43346819 attagtcgctcatctttggtgggtcggaaaccagtgcgaaagc 43346777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 4706124 - 4705983
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || ||||||||| ||||   | ||||||||||||||| |||||   || |||| | ||||||| ||||| ||| ||   |    
4706124 ggcaaggagctccttccaatgacgtatctaggaaatacatggttcgatttttagggggaacaacgtttagccattacgcatgcttctacgcacgagctgg 4706025  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||||| ||||| |||||| || |||||    
4706024 attagtcgtccacctttggtagatcgaaaaccgatgtgaaag 4705983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 10317820 - 10317744
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| ||||||| |||||||||  || ||| ||||||||| |  ||| |||||||||||||||||||||||||||||    
10317820 cttggtcagtgcgtatgcctctatgcataag-cagattagtcgctcacctttggtggatcggaaaccggtgcgaaagc 10317744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 21190855 - 21190778
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||||||||||||| ||| |||||||||||| | |||    |||||| ||| ||||||||||||||||    
21190855 cttggctagtgcgcatgcctctacgcacgagtcagattagtcgcccatcaatggtgggtcgaaaaccggtgcgaaagc 21190778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 123 - 235
Target Start/End: Complemental strand, 45697299 - 45697188
Alignment:
123 gggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaa 222  Q
    ||||||| ||||||||||| | ||||||| |||  ||||  |||||||||||||||||| ||  |||  | ||||| |||||| |||||||| |||||||    
45697299 gggaatatcagattcgattctcaggggaa-caacacttgatcagtgcgcatgcctctacgcatgagttgggttagtcgtccacctttggtgggtcggaaa 45697201  T
223 ccggtgcgaaagc 235  Q
    || || |||||||    
45697200 ccagtacgaaagc 45697188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 24969464 - 24969324
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||  ||||||||| |||||| |  |||| | | ||||||||  ||||  |||||  |||||||||||||| |||||||||  ||||||| |    
24969464 ggcaaggagcttttttcaaggacgtatctggaaaataccgggttcgatttccaggg--aacaacacttggccagtgcgcgtgcctctacgtacaagtcgg 24969367  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |  ||  |||| ||| ||||||||||||||||||||    
24969366 attaatcgctcatctttgatggctcggaaaccggtgcgaaagc 24969324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 158 - 229
Target Start/End: Complemental strand, 45960078 - 45960007
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgc 229  Q
    ||||| |||||||||||||||||| || ||| | ||||||| |  ||| |||| ||||||||||||||||||    
45960078 cttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttgatggatcggaaaccggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 16802092 - 16802234
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| |||||| ||| |  ||||||| | ||||||||| ||||| | |||||   |||||||||||| |||||||||| ||| || | |    
16802092 ggcaatgagctccttccaaggacgtacccggggaataccggattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgcacgagccgg 16802191  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  |||  ||||||| ||| |||| ||||| |||||    
16802192 attagtcgctcaccattggtgggtcgaaaactggtgcaaaagc 16802234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 189 - 235
Target Start/End: Complemental strand, 22268085 - 22268039
Alignment:
189 tcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||| |  ||| |||||||||||||||||||||||||||||    
22268085 tcagattagtcgctcacctttggtggatcggaaaccggtgcgaaagc 22268039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 43925481 - 43925623
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||||| |||||  ||||| |||||||||||||||||| ||  ||   |    
43925481 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctgg 43925580  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||  || |||| |||||| ||||||| || ||||||    
43925581 attagttgtttacctttgatggatcagaaaccgatgtgaaagc 43925623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 47341897 - 47341987
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||| ||   |||| || || |||  ||||||| ||||||| ||||||||||||    
47341897 agggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtcggaaatcggtgcgaaagc 47341987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 96 - 181
Target Start/End: Complemental strand, 7774519 - 7774434
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||| ||||||||| |||||||| |||||   | || |||| |||||||||||||  |||||||||| || ||||| ||||    
7774519 aaggagctcatttcaaggacgtatctagagaatacttggtttgattcttaggggaaacaacccttggccagtacgtatgccgctac 7774434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 235
Target Start/End: Complemental strand, 48244483 - 48244354
Alignment:
106 tttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccac 205  Q
    ||||||||| |||| | ||||||| | | ||| |||| || ||| |||||| ||||  |||||||  ||||||||| ||  || | ||||||| |  |||    
48244483 tttcaaggacgtatttggggaataccgggttcaatttctaaggggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcac 48244384  T
206 ttttggtggatcggaaaccggtgcgaaagc 235  Q
     |||||||||||| ||||||||||||||||    
48244383 ctttggtggatcgaaaaccggtgcgaaagc 48244354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 207 - 235
Target Start/End: Original strand, 12422128 - 12422156
Alignment:
207 tttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||||||||    
12422128 tttggtggatcggaaaccggtgcgaaagc 12422156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 122 - 198
Target Start/End: Original strand, 30827290 - 30827366
Alignment:
122 agggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    |||||||| ||| ||||||||| ||||  |||||  |||||||||| ||||||||||||| ||| || | |||||||    
30827290 agggaataccaggttcgattttcagggagaacaacacttggccagtacgcatgcctctacgcacgagccggattagt 30827366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 42210336 - 42210260
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||||| ||| || | ||||| |   ||||  ||||||| |||||||||| |||||||||    
42210336 ttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagc 42210260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 49142767 - 49142667
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||  |||||| |||||  ||| |||||||| ||||||||||| ||| || | ||||||||| |||| |||| ||| ||| |||  ||||||||||    
49142767 ttcgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaaattggtgcgaaag 49142668  T
235 c 235  Q
    |    
49142667 c 49142667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 29)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 3418653 - 3418511
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||| ||||||| | | ||||||||||||| | |||||  |||||||||||||||||| ||||| ||  ||||||    
3418653 ggcaaggagctccttccaaggacgtatctggggaatatcgggttcgatttttaggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcag 3418554  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| ||| |||| || |||||||||||||||||    
3418553 attagtcgtccacctttagtgggtcagaaaccggtgcgaaagc 3418511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 14666211 - 14666069
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| |||||  ||||||| | | |||||||   |||||||||||  |||||||||||||||||||||||| |||||| |||    
14666211 ggcaaggagctcattccaaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccag 14666112  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | ||||  ||||||| ||| ||||||||||||||||    
14666111 attagtcgcccacagttggtgggtcgaaaaccggtgcgaaagc 14666069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 43032871 - 43033013
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||  |||||||| || |||| | |||||||||   ||||| |||||  |||||||||||||||||||||||||||| || | |    
43032871 ggcaaggagttccttccaaaaatgtatctgggaaatatcggattcgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccgg 43032970  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| || |||||||||||||||||    
43032971 attagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 43033013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 2467258 - 2467116
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | ||||||||  ||||| ||||| |||||||||||||||||| |||||  ||  || | |    
2467258 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccgg 2467159  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||  ||||||||||||||||||||    
2467158 attagtcgtccacaattggtgtgtcggaaaccggtgcgaaagc 2467116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 17981411 - 17981553
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||||||| |  || |||| | | |||||||   ||||| ||||| ||||| |||||| |||||||||||| ||| ||||      
17981411 ggcaaggagctccttccaaggatgtacccgggaaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcga 17981510  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||| |||  |||||||  ||||||||||||||||||||    
17981511 attagttgcccagctttggtgagtcggaaaccggtgcgaaagc 17981553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 96 - 233
Target Start/End: Complemental strand, 15884692 - 15884556
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    |||||||||||| |||||| ||| || ||||||| | | |||||||   ||||||| |||  |||||| ||||||||||||||||| ||| || | ||||    
15884692 aaggagctccttccaaggacgtacctggggaataccgggttcgattcccaggggaa-caacacttggcaagtgcgcatgcctctacgcacgagccggatt 15884594  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||| | |||| |||||||| ||||||||||||||||||    
15884593 agtcgcccacctttggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 9860136 - 9859993
Alignment:
93 ggcaaggagctcctttcaaggatgtatctaggg-aataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtca 191  Q
    ||||| ||||||||| |||||| |||||  ||| |||| | | |||||||   ||||| |||||  ||||||||||| |||||||||||||||  || ||    
9860136 ggcaaagagctccttccaaggacgtatccgggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagcca 9860037  T
192 gattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||| ||||||  |||||||||||||||||| ||| |||||    
9860036 gattagtcgtccaccattggtggatcggaaaccgatgcaaaagc 9859993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8141072 - 8141214
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| ||| |||||| ||||   ||||||| | | ||||||||  |||||||||||  |||||||||||||||||||||||| ||  ||        
8141072 ggcaaggagctgcttccaaggacgtattcggggaataccgggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctga 8141171  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| || ||||||| |||||||||    
8141172 attagtcgtccacatttggtgggtcagaaaccgatgcgaaagc 8141214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 10927576 - 10927718
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| |||||||||| ||| |  ||||||| | | |||||||  |||| | |||||  |||||||||||||||||||||||| ||  || | |    
10927576 ggcaaggagcttctttcaaggacgtacccggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgg 10927675  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| |||||||||| |||||||||    
10927676 attagtcgttcacctttagtgggtcggaaaccgatgcgaaagc 10927718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 14846546 - 14846687
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| ||||||||  ||||| ||| |  ||||||| | | ||||||| | ||||||| ||||  |||| |||||||||||||||||| ||  ||||||    
14846546 ggcaagaagctccttctaaggacgtacccggggaataccgggttcgattctcaggggaa-caatgattggtcagtgcgcatgcctctacgcatgagtcag 14846644  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || ||| |||||| |||||||| ||||||| ||||||||||||    
14846645 ataagtcgtccacctttggtgggtcggaaatcggtgcgaaagc 14846687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 30903336 - 30903408
Alignment:
123 gggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    ||||||| | ||||||||||| |||| ||||||| |||| |||||||||||||| |||||||||||||||||||    
30903336 gggaataccggattcgattttcaggg-aaacaatgcttgaccagtgcgcatgccgctacacacaagtcagatta 30903408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 4479435 - 4479296
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| || |||||||||||| ||| ||   ||||| | |||||||||   ||||||| |||  |||||||||||||||||||||||| ||  ||   |    
4479435 ggcaagaagttcctttcaaggacgtacctgtagaataccggattcgattcccaggggaa-caacgcttggccagtgcgcatgcctctacgcatgagctgg 4479337  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| |||||| |||||||| ||||||||||||||||||    
4479336 attagtcgtccacctttggtgggtcggaaaccggtgcgaaa 4479296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 6100442 - 6100584
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| |||||  ||||||| | | |||||||   ||| | |||||  ||||||||||||||||||| |||| ||  || | |    
6100442 ggcaaggagctcctttcaaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccgg 6100541  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| ||| |||||| |||||||||    
6100542 attagtcgttcacctttagtgggtcgaaaaccgctgcgaaagc 6100584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 33401939 - 33401799
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| |||    ||||||| | | ||||||||| ||||| |||||  |||| |||||| |||||||||||| ||  |||| |    
33401939 ggcaaggagctcctttcaaggacgtactcggggaataccgggttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcgg 33401840  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | |||| ||| |||||||  |||||| ||||||||    
33401839 attagtcgcccacctttagtggatc-aaaaccgatgcgaaag 33401799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 44893418 - 44893277
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | ||| |||| |||||| |||||| ||||||||||| |||||||||||| ||| || | |    
44893418 ggcaaggagctccttccaaggacgtacccggggaataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcctctacgcacgagccgg 44893319  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||| | |  |||  ||| ||| |||||||||||||| ||||    
44893318 attaatcgctcacccttgatgggtcggaaaccggtgcaaaag 44893277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 94 - 198
Target Start/End: Complemental strand, 33935874 - 33935770
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    ||||||||||||||| ||||||||| | | |||||| | |||||||||  |||||  |||||  |||||||||||||||||||| ||| ||  |||| ||    
33935874 gcaaggagctccttttaaggatgtacccaaggaataccggattcgattcctagggagaacaacacttggccagtgcgcatgcctatacgcatgagtcgga 33935775  T
194 ttagt 198  Q
    |||||    
33935774 ttagt 33935770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 181
Target Start/End: Complemental strand, 35496394 - 35496307
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||||||||| ||||||||| ||||| ||| |||| ||| ||| ||||| || ||||||||  ||||| ||||||||||||||||||    
35496394 ggcaaggagctcatttcaaggacgtatcgagg-aatatcaggttcaattttcagaggaaacaacacttggtcagtgcgcatgcctctac 35496307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 34710655 - 34710565
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||  |||||| ||||||||||||| |||||||||||| || |||| |||||   ||||||| ||| ||||| || |||||||    
34710655 aggggaaacaacacttggctagtgcgcatgcctttacacacaagtcggactagtcgtccatcattggtgggtcgaaaaccagtccgaaagc 34710565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 165 - 235
Target Start/End: Complemental strand, 39969983 - 39969913
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||  |||||||||||| | |||   ||| |||||||||||||| |||||||||    
39969983 agtgcgcatgcctctacacatgagtcagattagtcgcccatcattgatggatcggaaaccgatgcgaaagc 39969913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 583847 - 583924
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||| ||  |||| ||||||| | |||| |||| |||||  |||||||||||||||||    
583847 cttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc 583924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 164 - 233
Target Start/End: Complemental strand, 3379881 - 3379812
Alignment:
164 cagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||||||| |||||||  ||  |||| ||||||| ||||||||||||||| ||||||| ||||||||||    
3379881 cagtgcgcacgcctctatgcatgagtcggattagtcgtccacttttggtgggtcggaaatcggtgcgaaa 3379812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 18373980 - 18374121
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || ||| ||| ||||  || |||| ||| ||||||| | ||||  |||||  |||| ||||||||||||||||||| ||  || | |    
18373980 ggcaaggagctcattccaaagatatatccgggaaataccaggttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccgg 18374079  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||  |||||||| ||| |||||||||| ||||    
18374080 attagtcgtccaactttggtgggtcgaaaaccggtgcaaaag 18374121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 24837277 - 24837354
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||  ||||||||||  ||| ||   ||||||| |||||| ||||||||||||||||| |||||||||||    
24837277 cttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaagc 24837354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 7673794 - 7673657
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||| ||||||| ||  |||||   ||||||| |||||   ||||| |||| |||||||||||| ||| || | |    
7673794 ggcaaggagctccttccaaggacgtatctggggaatatcaagttcga---ttagggggaacaacgtttggctagtgtgcatgcctctacgcacgagccgg 7673698  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||  | | |||  ||| |||||||| ||||||||||||||    
7673697 atttttcgcccatctttagtggatcgaaaaccggtgcgaaa 7673657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 187
Target Start/End: Complemental strand, 9395958 - 9395865
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaa 187  Q
    ||||| |||||| |||||||||||||||| ||||||| | ||||||| ||| ||  ||||||||  ||| || |||| ||||||||||| |||||    
9395958 ggcaatgagctcatttcaaggatgtatctggggaatatcggattcga-tttcagaagaaacaatatttgacccgtgcacatgcctctacgcacaa 9395865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 163 - 225
Target Start/End: Original strand, 12754065 - 12754127
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccg 225  Q
    ||||||||||||||||||  |||||||||||||||| |  ||  |||| ||||||||||||||    
12754065 ccagtgcgcatgcctctatgcacaagtcagattagtcgctcatctttgatggatcggaaaccg 12754127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 2964111 - 2964188
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||| || |||||||||||| ||| |  | ||||||| | |||| |||||||| || |||||||||||||||||    
2964111 cttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 2964188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 162 - 235
Target Start/End: Complemental strand, 8997615 - 8997542
Alignment:
162 gccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||||| ||| ||  || ||||||||| || ||  |||||||| ||||||||||||||||||||    
8997615 gccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaagc 8997542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 23895603 - 23895679
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||| ||||||| ||| ||   ||||| | |||||| |||| ||| |||||||| ||||||||||    
23895603 cttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag 23895679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 26)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 13036144 - 13036002
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||||   ||||||| | | ||||||||| ||||| |||||  |||||||||||||||||||||||| ||  || |||    
13036144 ggcaaggagctccttccaaggacgtattcggggaatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccag 13036045  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||| ||||||| ||||||||||||||||||||    
13036044 attagtcgtccactattggtgggtcggaaaccggtgcgaaagc 13036002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 101 - 235
Target Start/End: Original strand, 12635792 - 12635926
Alignment:
101 gctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttg 200  Q
    ||||||| |||||| |||||  ||||||| ||| || ||||   |||||||||||  |||||| ||||||||||||||||| |||||| | ||||||| |    
12635792 gctccttccaaggacgtatccggggaataccaggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcg 12635891  T
201 tccacttttggtggatcggaaaccggtgcgaaagc 235  Q
     ||||| ||||||| ||||||||||||||||||||    
12635892 cccactattggtgggtcggaaaccggtgcgaaagc 12635926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 135 - 235
Target Start/End: Original strand, 3601096 - 3601196
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||| | ||||| |||||  |||||||||||||||||||| ||||||| || | ||||||| |||||| |||||||| |||||||||||||||||||    
3601096 ttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 3601195  T
235 c 235  Q
    |    
3601196 c 3601196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 6606237 - 6606095
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | ||||||| | ||||| |||||  |||||||||||  ||||||||||| ||  || | |    
6606237 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccgg 6606138  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| ||||||||||||||||||||    
6606137 attagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 6606095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 94 - 235
Target Start/End: Original strand, 19089469 - 19089610
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    ||||||||||| ||||||||| |||||   |||||| ||| || ||||   ||||| |||||  ||||||||||| |||||||||||| ||| || | ||    
19089469 gcaaggagctcatttcaaggacgtatccgaggaataccaggtttgattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccgga 19089568  T
194 ttagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| ||| || |||||||| ||||||||||||||||||||    
19089569 ttagtcgtctacctttggtgggtcggaaaccggtgcgaaagc 19089610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 5253363 - 5253221
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
5253363 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 5253264  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | | |||| |||||||| ||||||||||||||||||||    
5253263 attaatcgcccacctttggtgggtcggaaaccggtgcgaaagc 5253221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 95 - 181
Target Start/End: Complemental strand, 9366561 - 9366475
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||| ||||||||||  | ||||||| ||| ||||||||||||||| || ||  ||||||||||||||||||||||||    
9366561 caaggagctccttccaaggatgtacttggggaatatcaggttcgatttttagggggaataacgcttggccagtgcgcatgcctctac 9366475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 12606400 - 12606542
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| |||| | |||||  ||||||| ||||||||||||  ||||| |||||   ||||||||||||||||||||||| ||| || | |    
12606400 ggcaatgagctccttccaagaacgtatccggggaataccagattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccgg 12606499  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||    ||||||||||||||||||    
12606500 attagtcgcccacctttggtgagctggaaaccggtgcgaaagc 12606542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 13468903 - 13469045
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| ||| ||| |||  |||||| |||||   |||| |||||| ||||||||||| ||| || |||    
13468903 ggcaaggagctccttccaaggacgtatccggggaataccaggttcaattcctagggggaacaacgattggtcagtgcacatgcctctacgcacgagccag 13469002  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | ||||  ||||||| | ||||||||||||||||||    
13469003 attagtcgcccaccattggtgggttggaaaccggtgcgaaagc 13469045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 21898618 - 21898760
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||| | |||||  |||||||||||||||||||||||| ||  || | |    
21898618 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgg 21898717  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| ||||||||||||||||||||    
21898718 attagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 21898760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 29444905 - 29444763
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || ||| |  ||| ||| | | |||||||| |||||| |||||  |||||||||||||||||||||||| ||  || | |    
29444905 ggcaaggagctccttccaaagacgtacccgggggataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccgg 29444806  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||  |||||||| ||||||||  ||||||||||    
29444805 attagttgtccatctttggtgggtcggaaactagtgcgaaagc 29444763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 34954759 - 34954617
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| || ||||||| ||| ||||||| | ||||| |||||   ||||||||||| ||| ||||||| ||  || |||    
34954759 ggcaaggagctccttccaaggacgtacctggggaataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccag 34954660  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||| ||| |||||||||  |||||||||    
34954659 attagtcgtccacctttgatgggtcggaaaccaatgcgaaagc 34954617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 9633700 - 9633623
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||| || | ||||||| | |||| |||||||| ||||||||||||||||||||    
9633700 cttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 9633623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 93 - 224
Target Start/End: Original strand, 8888852 - 8888983
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| |  ||| ||||| ||||| |||||||| |  |||||||||||| |||||||||   ||||||||||||||| ||||||| ||  |||| |    
8888852 ggcaaggagttttttttaaggacgtatccagggaatatcgaattcgatttttaagggaaacaacgtttggccagtgcgcatacctctacgcatgagtcgg 8888951  T
193 attagttgtccacttttggtggatcggaaacc 224  Q
    |||||| |||||| |||| ||||||| |||||    
8888952 attagtcgtccacctttgatggatcgaaaacc 8888983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 30788991 - 30788851
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||||||||||||  ||||||| | | || |||| | | ||  |||||   ||||||||||||||||||||||  ||| || | |    
30788991 ggcaaggagctccttccaaggatgtatccggggaatatcgggtttgattctcatgg--aacaacgtttggccagtgcgcatgcctctaggcacgagccgg 30788894  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||||||||||||||||||||    
30788893 attagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 30788851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 163 - 233
Target Start/End: Original strand, 11142643 - 11142713
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||||||||||||||||| ||  ||||||||||||||||||  |||||||| ||||| ||||||||||||    
11142643 ccagtgcgcatgcctctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa 11142713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 31129212 - 31129289
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||||||||||||| ||  || |||||||||||| ||| |||||||  ||||||||||||||||||||    
31129212 cttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc 31129289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8932631 - 8932773
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| ||||||||||||  ||||||| | | |||||||   ||||| |||||  |||||| ||||||||||||||||| ||  || | |    
8932631 ggcaaggagttccttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccgg 8932730  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |   |||| |||| ||| ||||||||||||||||||||    
8932731 attaatcacccacctttgatgggtcggaaaccggtgcgaaagc 8932773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8944097 - 8944239
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| ||||||||||||  ||||||| | | |||||||   ||||| |||||  |||||| ||||||||||||||||| ||  || | |    
8944097 ggcaaggagttccttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccgg 8944196  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |   |||| |||| ||| ||||||||||||||||||||    
8944197 attaatcacccacctttgatgggtcggaaaccggtgcgaaagc 8944239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 24672006 - 24671865
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| |||||| | ||||| | | ||| |||   || || |||||  |||| |||||| |||||||||||| |||||| | |    
24672006 ggcaaggagctcctttcaaggacgtatctggagaataccgggttctattcccagagggaacaacacttgaccagtgtgcatgcctctacgcacaagccgg 24671907  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||| | |||| ||| ||||||| ||||| |||||    
24671906 attagtagtccgcctttgatggttcggaaatcggtgtgaaag 24671865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 96 - 233
Target Start/End: Complemental strand, 32157304 - 32157167
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    ||||||||||||  |||||  ||| ||||||||| ||| ||  |||||||| || |||||  |||| ||||||||||| ||||||| ||  || ||||||    
32157304 aaggagctccttctaaggacatatttagggaatatcaggtttaatttttagagggaacaacacttgaccagtgcgcatacctctacgcatgagccagatt 32157205  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||  ||||  ||||||||||| |||||||||| ||||    
32157204 agtcatccatctttggtggatcagaaaccggtgtgaaa 32157167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 94 - 236
Target Start/End: Complemental strand, 10311608 - 10311466
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    |||||||||||||| |||| | |||||  ||||||| | | ||||||  | | ||| |||||  ||||||||||||||||| |||||| ||| ||| |||    
10311608 gcaaggagctccttccaagaacgtatccggggaataccgggttcgatcctcaaggggaacaacgcttggccagtgcgcatgtctctacgcacgagttaga 10311509  T
194 ttagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||| |  |||  ||||||| ||| |||| ||||||||||||    
10311508 ttagtcgctcaccattggtgggtcgaaaactggtgcgaaagct 10311466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 29333278 - 29333138
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| |||||| ||| | |||||||| | | ||||||||  ||||||| |||   ||||||||||||||||||||||| ||  || |      
29333278 ggcaatgagctccttccaaggacgtacccagggaataccgggttcgatttccaggggaa-caacgtttggccagtgcgcatgcctctacgcatgagccga 29333180  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    || ||| |||||| |||||| | |||| ||||||||||||||    
29333179 atcagtcgtccacctttggtaggtcggtaaccggtgcgaaag 29333138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 14783494 - 14783418
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||| |||||||||||| ||  || | ||||||| ||||||  ||||||| ||||||||||||||||||||    
14783494 ttggctagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 14783418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 9179876 - 9179735
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| ||| | |||||||| | | |||||||   ||||| |||||  |||| |||||  |||| ||||||| ||  ||   |    
9179876 ggcaaggagctcattccaaggacgtacccagggaataccgggttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctgg 9179777  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||||||||||||||| |||| ||||||    
9179776 attagtcgtccacctttggtggatcggaaatcggtccgaaag 9179735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 13391297 - 13391361
Alignment:
133 gattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    ||||||||||| ||||||| ||||  ||||||||||||||||||||||| ||| || | |||||||    
13391297 gattcgattttcaggggaa-caatgtttggccagtgcgcatgcctctacgcacgagccggattagt 13391361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 4e-27; HSPs: 53)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 25540544 - 25540402
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| |||||| |||||||   | |||||||  |||||| |||||  |||||||||||||||||||||||| ||| || | |    
25540544 ggcaaggagctcattccaaggacgtatctggggaatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccgg 25540445  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| ||||||||||||||||||||    
25540444 attagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 25540402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 14853507 - 14853364
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgc--ctctacacacaagtc 190  Q
    |||||||| |||||||||||||||||||  ||||||| ||||||||||||| ||||| ||||| | |||||||||||| ||||  |||||| ||  ||||    
14853507 ggcaaggaactcctttcaaggatgtatccggggaataccagattcgattttcagggggaacaacttttggccagtgcgtatgcctctctactcatgagtc 14853408  T
191 agattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
     ||||||| |||||  ||| ||||||| |||| ||||||||||||    
14853407 ggattagtcgtccatctttagtggatc-gaaatcggtgcgaaagc 14853364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8410097 - 8410239
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  | ||||| | | |||||||   ||||| |||||  |||||||||||||||||||||||| ||| || | |    
8410097 ggcaaggagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccgg 8410196  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||||||||| || ||||||||||||||||||||    
8410197 attagtcgcccacttttggggggtcggaaaccggtgcgaaagc 8410239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 95 - 234
Target Start/End: Original strand, 12864192 - 12864331
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    ||||||||||||| ||| || ||||   ||||||| | ||||||||||  ||||| |||||  ||||| |||||||||||||||| | ||  || |||||    
12864192 caaggagctccttccaatgacgtattcggggaataccggattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagat 12864291  T
195 tagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||| ||||||  ||||||| |||||||||||||||||||    
12864292 tagtcgtccaccattggtgggtcggaaaccggtgcgaaag 12864331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 38005368 - 38005510
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  |||||||   | |||||||   | ||| |||||  |||||||||||||||||||||||||||  || | |    
38005368 ggcaaggagctccttccaaggacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccgg 38005467  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| ||||||||||||||||| |||||||||||    
38005468 attagtcgcccacctttggtggatcggaaactggtgcgaaagc 38005510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 96 - 234
Target Start/End: Original strand, 38962732 - 38962870
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    ||||||||| ||||||||| |||||  ||||||| | | ||||||||| ||| | |||||  |||||||||||||||||||||||| ||  |  | ||||    
38962732 aaggagctcatttcaaggacgtatccggggaataccgggttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggatt 38962831  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||| |||||| |||||||| || ||||| ||||||||||    
38962832 agtcgtccacctttggtgggtcagaaactggtgcgaaag 38962870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 6358291 - 6358150
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| ||||| ||  ||||| |||||  ||||||| ||||||||||||  ||||| |||||  |||||||||||||||||||||||| ||  || | |    
6358291 ggcaagaagctcattcaaaggacgtatccggggaataccagattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 6358192  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| ||||||  ||||||| ||| ||||||||| |||||    
6358191 attagtcgtccaccattggtgggtcgaaaaccggtgtgaaag 6358150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 93 - 229
Target Start/End: Original strand, 7787022 - 7787158
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||| |||||||| |||| ||| |  ||||||| | | ||||||||  ||||| |||||| |||||||||| ||||||||||||| ||| || | |    
7787022 ggcaaggaactcctttctaggacgtacccggggaataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccgg 7787121  T
193 attagttgtccacttttggtggatcggaaaccggtgc 229  Q
    |||||| | |||  |||||||||||| ||||||||||    
7787122 attagtcgcccatctttggtggatcgaaaaccggtgc 7787158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 96 - 235
Target Start/End: Complemental strand, 15234198 - 15234059
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    |||||||||||| |||||| ||| |  |||||||  || ||||||| | ||||| |||||  |||| ||||||||||||||||||| ||||||| |||||    
15234198 aaggagctccttccaaggacgtacccggggaatactaggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagatt 15234099  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||| || ||  |||| | | |||||||||| |||||||||    
15234098 agtcgttcatctttgataggtcggaaaccgatgcgaaagc 15234059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 159 - 234
Target Start/End: Complemental strand, 39806959 - 39806884
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||||||||||||||||||| |||| |||||||  ||||| |||||||| ||  |||||||||||||||    
39806959 ttggccagtgcgcatgcctctacacacgagtcggattagtcatccacctttggtggttcataaaccggtgcgaaag 39806884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 7747240 - 7747382
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||  |||| | |||||   |||||||||| |||||||||||| ||  || | |    
7747240 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccgg 7747339  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| ||||||||||||||||||||    
7747340 attagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 7747382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 16325613 - 16325703
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  ||||||||||| |||||||||||| ||  || ||||||||| ||||||  ||||||| ||||||||||||||||||||    
16325613 agggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 16325703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 235
Target Start/End: Original strand, 44139454 - 44139592
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    |||| |||||| |||||||| |||| ||||||| | | |||||||   ||||| |||||  |||||||||||||| ||||||||| ||| || | |||||    
44139454 aggaactccttccaaggatgcatctggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggatta 44139553  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || | ||||   |||||| ||||||||||||||||||||    
44139554 gtcgcccaccaatggtgggtcggaaaccggtgcgaaagc 44139592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 10823091 - 10823168
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||| || | ||||||| | |||| ||| |||| ||||||||||||||||||||    
10823091 cttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaagc 10823168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 18649166 - 18649025
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| |||| ||| |||||||| ||  |||||||| | ||||||||| | ||| | ||||||  |||| |||||||||||||||||| ||  |||| |    
18649166 ggcaagaagctgcttccaaggatgcattcagggaataccggattcgattctcaggaggaacaatatttgggcagtgcgcatgcctctacgcatgagtcgg 18649067  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |  |||||||||||| | |||||||| ||||||||    
18649066 attagtcgctcacttttggtgggttggaaaccgttgcgaaag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 135 - 235
Target Start/End: Original strand, 12455318 - 12455418
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||  |||||||||||  ||| |||||||||||||||||||| ||| || | ||||||| |  |||  ||||||| |||||||||||||||||||    
12455318 ttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaag 12455417  T
235 c 235  Q
    |    
12455418 c 12455418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 95 - 235
Target Start/End: Complemental strand, 34346425 - 34346285
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    |||||||||| || |||||| ||| || |||||||   | || |||| | ||||| |||||  ||||||||||| |||||||||||| ||  ||||||||    
34346425 caaggagctcattccaaggacgtacctggggaatactgggtttgattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagat 34346326  T
195 tagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || | |  ||| |||||||| ||||||||||||||||||||    
34346325 taatcgctcacctttggtgggtcggaaaccggtgcgaaagc 34346285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 93 - 236
Target Start/End: Complemental strand, 41032045 - 41031903
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| | |||||| | | | |||||||   ||||| |||||  ||||||||||| |||||||||||| ||| || | |    
41032045 ggcaaggagctccttccaaggacgtacc-agggaacaccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccgg 41031947  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||||   |||| |||||||| ||||||||| |||||||||||    
41031946 attagtcacccacctttggtgggtcggaaaccagtgcgaaagct 41031903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 92 - 234
Target Start/End: Complemental strand, 9360889 - 9360747
Alignment:
92 gggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtca 191  Q
    ||||||||| ||| || |||||| ||| |  ||||||| ||| |||||||  ||| ||||||||   ||||||||||||||||||||||| ||| || |     
9360889 gggcaaggatctcattccaaggacgtacccggggaataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccg 9360790  T
192 gattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
     |||||| | |||| ||| ||||  ||||||||||||||||||    
9360789 aattagtcgcccacctttagtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 13026551 - 13026409
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||| |||||| |||||| ||||| |||||||| | | ||||||| | ||| | ||||||  ||||||||||||||||||||||| ||  || | |    
13026551 ggcaaggaactccttccaaggacgtatccagggaatatcgggttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcatgagccgg 13026452  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||   ||||||||||| | || ||||||| ||| |||||    
13026451 attagtcagccacttttggtaggtcagaaaccgatgcaaaagc 13026409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 18902670 - 18902528
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||    ||||||| | | |||||||   | ||| |||||  |||| ||||||||| || |||||| ||| || |||    
18902670 ggcaaggagctccttccaaggacgtactcggggaataccgggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccag 18902571  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||||||||||||||||||||    
18902570 attagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 18902528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 41220601 - 41220743
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||| | |||||  |||||||||||||||||||||||| ||  || |      
41220601 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccga 41220700  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || ||| ||| |||| ||||||||||||||||||||    
41220701 attagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 41220743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 44945631 - 44945701
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||| ||| || | ||||||| | |||| ||| |||||||||||||||||||||||||    
44945631 agtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc 44945701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 2550834 - 2550975
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||| | |||||  ||| ||||||||||||| |||||| ||  || | |    
2550834 ggcaaggagctccttacaaggacgtatccggggaatatcgggttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccgg 2550933  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | ||||||||||||| | | |||||||||||||||    
2550934 attagtcgcccacttttggtgggttgaaaaccggtgcgaaag 2550975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 94 - 235
Target Start/End: Original strand, 29422182 - 29422323
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    ||||||||||||||||||||| ||| |  |||||||   | ||||||||  || || |||||  |||||||| || |||| ||| ||| ||| || | ||    
29422182 gcaaggagctcctttcaaggacgtacccggggaatactgggttcgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccgga 29422281  T
194 ttagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||| |||| ||||||||||| ||||||||||||    
29422282 ttagtcgtccacctttgatggatcggaaatcggtgcgaaagc 29422323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 22593166 - 22593241
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||||| ||  || | ||||||| |||||| |||||||| |||| |||||||||||||||    
22593166 ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaagc 22593241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 28616477 - 28616377
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||| ||||| || ||  ||||| |||||||||||||||||| ||| || ||||||||| | |||  ||| |||| || ||||||||||||||||    
28616477 ttcgattttcagggggaataacacttgggcagtgcgcatgcctctacgcacgagccagattagtcgcccatctttagtgggtcagaaaccggtgcgaaag 28616378  T
235 c 235  Q
    |    
28616377 c 28616377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 228
Target Start/End: Complemental strand, 39201648 - 39201513
Alignment:
93 ggcaaggagctcctttcaaggatgtatctag-ggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtca 191  Q
    ||||||||||||||| |||||| ||| || | |||||| |  |||||||| | ||||| ||||||  |||||||||| |||||||||||| ||  || |     
39201648 ggcaaggagctccttccaaggacgta-ctcgaggaataccgaattcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccg 39201550  T
192 gattagttgtccacttttggtggatcggaaaccggtg 228  Q
    ||||||| || ||| |||||||| |||||||||||||    
39201549 gattagtcgttcacctttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 94 - 233
Target Start/End: Original strand, 2784900 - 2785038
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    |||| |||||||||||||||| |||||   |||||| |   ||||||||| |||| ||||||   |||| |||||||||||||||||| ||  |||||||    
2784900 gcaatgagctcctttcaaggacgtatccgaggaataccgagttcgattttcaggg-aaacaagatttggtcagtgcgcatgcctctacgcatgagtcaga 2784998  T
194 ttagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    ||||| |||||   ||| ||  ||||||||||||||||||    
2784999 ttagtcgtccatcattgatgagtcggaaaccggtgcgaaa 2785038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 96 - 235
Target Start/End: Complemental strand, 3644024 - 3643885
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    ||||||||| || |||||| |||||  ||||||| | | || ||||| || | | |||||  |||||||||||||||||||||||| ||  ||   ||||    
3644024 aaggagctcattccaaggacgtatccggggaataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctctacgcatgagctggatt 3643925  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||| |||||| ||||||||  ||||||||| |||||||||    
3643924 agtcgtccacctttggtgggccggaaaccgttgcgaaagc 3643885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 158 - 229
Target Start/End: Original strand, 10669623 - 10669694
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgc 229  Q
    ||||||||||||||||| |||||| ||| |||| ||||| | || ||| |||||||| ||||||||||||||    
10669623 cttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtgc 10669694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 151 - 234
Target Start/End: Original strand, 27725964 - 27726047
Alignment:
151 aacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||||||||||||||||||||| ||| || | ||||||| | ||||   |||||| ||||||||||||| |||||    
27725964 aacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaag 27726047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 234
Target Start/End: Complemental strand, 3849051 - 3848913
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    |||||| || ||||||||| |||||| | ||||| | | ||||||| | |||||||||||   |||||||| ||||||| |||||| ||| |||| ||||    
3849051 aaggagttcatttcaaggacgtatctggagaataccgggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggatt 3848952  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||| || ||| |||| ||| ||| |||  ||||||||||    
3848951 agtcgttcacctttgatgggtcgaaaattggtgcgaaag 3848913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 20612676 - 20612534
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttagg-ggaaacaattcttggccagtgcgcatgcctctacacacaagtc- 190  Q
    ||||||||||||||| ||||| |||||   ||||||| | | ||||||| | ||| || |||||  |||||||||||||||||||||||  ||  || |     
20612676 ggcaaggagctccttccaaggttgtattcggggaataccgggttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatgagccg 20612577  T
191 agattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
     ||||||| ||||||  ||||||| ||||||||||||||||||    
20612576 ggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 20612534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 25549694 - 25549836
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||| | |||| | |||||||   | ||||||| |||||| ||||||   ||||| ||||| ||||||||||| ||| || | |    
25549694 ggcaaggagctccttccaagtacgtatttggggaatactgggttcgattcttagggaaaacaacatttggctagtgcacatgcctctacgcacgagccgg 25549793  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||  |||| ||||||| ||| |||||| |||||    
25549794 attagtcgtccatctttgatggatcgtaaatcggtgcaaaagc 25549836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 19976947 - 19976806
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| ||||| || |||||| |||||  ||||||| | | ||||||||| ||||| || ||   |||| ||||||||||| |||||| || |||||      
19976947 ggcaagtagctctttccaaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcataagtcga 19976848  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | |||| |||| || |||||||| |||||||||||    
19976847 attagtcgcccacctttgatgaatcggaaatcggtgcgaaag 19976806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 146 - 235
Target Start/End: Complemental strand, 28525542 - 28525453
Alignment:
146 ggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||  |||||||||||||||||||||||| ||| || | |||||||  ||||| |||  ||| |||||||| |||| ||||||    
28525542 ggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtgtgaaagc 28525453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 21286410 - 21286498
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| |||||| |||||  ||||||| | | |||||||   ||| |||||||  |||| |||||||||||||||||||    
21286410 ggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctac 21286498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 35946769 - 35946845
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||| || |||||||||||| ||| || | ||||||| ||||||  ||||||| |||||||| ||||||||||    
35946769 cttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag 35946845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 160 - 235
Target Start/End: Complemental strand, 20116685 - 20116610
Alignment:
160 tggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||||||||||| ||  || | ||||||  |||||| |||| ||| ||||||||||||||||||||    
20116685 tggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagc 20116610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 231
Target Start/End: Complemental strand, 31740870 - 31740763
Alignment:
124 ggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaac 223  Q
    |||||| ||||||||||| | ||||   ||||  ||||| ||||||| |||| ||||  ||| ||||||| |||| |||||| |||||||||||| ||||    
31740870 ggaataccagattcgattatcagggattacaacgcttggtcagtgcgaatgcttctaggcacgagtcagactagtcgtccacctttggtggatcgaaaac 31740771  T
224 cggtgcga 231  Q
     |||||||    
31740770 tggtgcga 31740763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 93 - 180
Target Start/End: Original strand, 34356172 - 34356259
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctcta 180  Q
    |||||||||||  || |||||| |||||| ||||||| | | ||||||||  ||||| |||||  ||||| |||||||||||||||||    
34356172 ggcaaggagctatttccaaggacgtatctggggaataccgggttcgatttccagggggaacaacacttggtcagtgcgcatgcctcta 34356259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 97 - 235
Target Start/End: Original strand, 11069848 - 11069986
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    |||||||| || |||||| ||| |  ||||||| ||| |||||||   ||||| |||||   ||||||||||||||| ||||||| ||| ||    ||||    
11069848 aggagctcattccaaggacgtacccggggaataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaatta 11069947  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || ||||||  ||||||| |||||||||| |||||||||    
11069948 gtcgtccaccgttggtgggtcggaaaccgatgcgaaagc 11069986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 42770739 - 42770649
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||| | ||| || | ||||| | |||||| |||||||| ||| |||||| ||| |||||    
42770739 agggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaaccgatgcaaaagc 42770649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 34722711 - 34722788
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||| |||| |||||| ||| || | ||||||| | |||| |||| |||||| |||||||||||||||||    
34722711 cttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaagc 34722788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 190 - 235
Target Start/End: Complemental strand, 44548767 - 44548722
Alignment:
190 cagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||| |||||| |||| |||||||||||| |||||||||||    
44548767 cagattagtcgtccacctttgatggatcggaaactggtgcgaaagc 44548722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 223
Target Start/End: Complemental strand, 10026690 - 10026626
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaac 223  Q
    ||||||||||||||||||||||| ||  || | ||||||| | |||| |||||||| ||||||||    
10026690 ttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Complemental strand, 14169684 - 14169608
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||| |||||||||||| |||||| ||  || | ||||||| ||| ||  ||||||| |||||||||||||||||||    
14169684 cttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaag 14169608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 26805328 - 26805404
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| ||||||||||| ||  |||| ||||||| | |||| |||||||| ||| |||||| ||| |||||    
26805328 ttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccgatgcaaaagc 26805404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 33005782 - 33005858
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||||||||||||||||||||| ||  || ||||||| | |  ||| ||| |||| |||||||||| ||||||||    
33005782 cttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 37560205 - 37560281
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| |||||||||||||||||| ||| || | ||||| | |||||| |||| ||| ||| ||||||||| ||||||    
37560205 ttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtgtgaaagc 37560281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 41187815 - 41187903
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| |||||| |||||   |||||| |  |||| ||| |||||  ||||||  |||| |||||||||||||||||||    
41187815 ggcaaggagctccttccaaggacgtatccgaggaataccgaattcaattcttaggaaaaacaacgcttgaccagtgcgcatgcctctac 41187903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Complemental strand, 45263807 - 45263719
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||||||||||||||||  || ||||  ||||||| | | |||||||   || || |||||  ||||||||||||||||||||||||    
45263807 ggcaaggagctcctttcaaaaatttatccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctctac 45263719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 62; Significance: 1e-26; HSPs: 51)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 105 - 234
Target Start/End: Original strand, 16263524 - 16263653
Alignment:
105 ctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtcca 204  Q
    |||||||||| |||||| ||||||| ||| ||||||||  ||| | |||||  |||||||||||||||||||||||| || ||| | || |||| |||||    
16263524 ctttcaaggacgtatctggggaataccaggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtcca 16263623  T
205 cttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||||||||||||||||||||    
16263624 cttttgatggatcggaaaccggtgcgaaag 16263653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 2567243 - 2567384
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||||   | ||||| | | |||||||||  ||| ||||||  |||||||||||||||||||||||| ||| ||||||    
2567243 ggcaaggagctccttccaaggacgtattcggagaataccgggttcgattttcggggaaaacaacgcttggccagtgcgcatgcctctactcacgagtcag 2567342  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||  |||||  |||||||| |||||||||||| ||||||    
2567343 attagccgtccatctttggtgggtcggaaaccggtacgaaag 2567384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 97 - 234
Target Start/End: Complemental strand, 33004152 - 33004015
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    ||||||||||| |||||| |||||  ||||||| | ||||||||||  |||||||||||| |||||||||||||||||||||||| ||| || | |||||    
33004152 aggagctccttccaaggacgtatccggggaatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggatta 33004053  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||   ||||   |||||| ||| |||||||||||||||    
33004052 gtcacccaccaatggtgggtcgaaaaccggtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 93 - 236
Target Start/End: Complemental strand, 12036885 - 12036741
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| |||||||| |||||| ||| |||| |||||   | || ||||  |||||| |||||| |||||||||||||||||||||||| ||| || |||    
12036885 ggcaagaagctccttccaaggacgtacctagagaatactgggtttgattcctagggggaacaatgcttggccagtgcgcatgcctctacgcacgagccag 12036786  T
193 attagttgtccacttttggtggatcgg-aaaccggtgcgaaagct 236  Q
    |||| | |||||| ||||||||||||| ||||| |||||||||||    
12036785 attaatcgtccacctttggtggatcggaaaaccagtgcgaaagct 12036741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 8763958 - 8764100
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||| ||   ||||| |||||  |||||||||||||||||||||||| ||| || | |    
8763958 ggcaaggagctccttccaaggacgtacccggggaatatcgggttcgtttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccgg 8764057  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| ||||||||||||||||||||    
8764058 attagtcgtccaccgttggtgggtcggaaaccggtgcgaaagc 8764100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 99 - 234
Target Start/End: Complemental strand, 18649487 - 18649352
Alignment:
99 gagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    ||||||||| |||||| |||||| | ||||| | | ||||||||| ||||| |||||  |||| |||||||||||||||||||  || || ||||||| |    
18649487 gagctccttccaaggacgtatctggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaat 18649388  T
199 tgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
     | |||| ||| |||||| |||||||||||||||||    
18649387 cgcccacctttagtggattggaaaccggtgcgaaag 18649352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 93 - 236
Target Start/End: Complemental strand, 45362023 - 45361880
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | ||||||| | ||| | |||||  ||||||||||||||||||| |||| || ||| | |    
45362023 ggcaaggagctccttccaaggacgtaccctgggaataccgggttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccgg 45361924  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    |||||| || ||| ||| |||| |||||||||||||||||||||    
45361923 attagtcgttcacctttagtgggtcggaaaccggtgcgaaagct 45361880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 10422755 - 10422897
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || ||||   ||||||| | | |||||||| |||| | |||||  |||||||||||||||||||||||| ||  || | |    
10422755 ggcaaggagctccttccaatgacgtattcggggaataccgggttcgatttctaggaggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 10422854  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| ||||||   ||||||||||||||||||||    
10422855 attagtcgtccacctttggtaagtcggaaaccggtgcgaaagc 10422897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 17642093 - 17642003
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||| || | ||||||| |||||| |||||||| |||||||| |||||||||||    
17642093 agggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 17642003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 26325779 - 26325921
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| |||||   |||||| | | |||||||   || || |||||  ||||| |||||||||||||||||| ||  || | |    
26325779 ggcaaggagctcctttcaaggacgtatccgaggaatatcgggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccgg 26325878  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| ||||||||||||||||||||    
26325879 attagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 26325921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 43959910 - 43959820
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||| || | ||||||| | |||| ||| |||||||||||||||||||||||||    
43959910 agggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc 43959820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 49078081 - 49078223
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||  ||||| |||||  ||||||| | | |||||||   |||||||||||  |||||||||||||||||||||||| ||  || | |    
49078081 ggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccgg 49078180  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| || |||  ||||| | ||||||||||||||||||||    
49078181 attagtcgttcaccattggtaggtcggaaaccggtgcgaaagc 49078223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 4581758 - 4581681
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||| || | || |||| |||||| |||||||| ||||||||||||||||||||    
4581758 cttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4581681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 11398029 - 11397888
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||||||||||||  | ||||| | | |||||||   ||||||| |||   ||||||| |||| |||||||||| ||  |||| |    
11398029 ggcaaggagctccttccaaggatgtatccggagaataccgggttcgattccgaggggaa-caacgtttggccaatgcgtatgcctctacgcatgagtcgg 11397931  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||||| ||||||| ||||||||||||    
11397930 attagtcgtccacctttggtgggtcggaaatcggtgcgaaagc 11397888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 30927868 - 30927726
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| || || |||| | | ||||||||  || || |||||  |||||||| || |||||||||||| ||  || | |    
30927868 ggcaaggagctccttccaaggacgtacctgggaaatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccgg 30927769  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||||||||||| || ||||||||||| |||||    
30927768 attagtcgtccacttttggtgggtcagaaaccggtgcaaaagc 30927726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 41663997 - 41663855
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||  ||||| |||||  ||||||| | | |||||||   ||||| |||||  ||||| |||||||||||||||||| ||  ||   |    
41663997 ggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctgg 41663898  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| ||||||||||||||||||||    
41663897 attagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 41663855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 135 - 225
Target Start/End: Complemental strand, 42710237 - 42710147
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccg 225  Q
    ||||||||| |||||||||||| |||||||||||||||||||||||| || ||  |  |||||| ||||||  ||||| ||||||||||||    
42710237 ttcgattttcaggggaaacaatacttggccagtgcgcatgcctctacgcataaaccgaattagtcgtccaccattggtagatcggaaaccg 42710147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 34719808 - 34719885
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||| ||| |||||||||||| |  ||| |||||||| |||||||| |||||||||||    
34719808 cttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 34719885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 50371975 - 50371834
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||  ||||||||||||    |||| |   ||||||||| |||   |||||  |||||||||| ||||||| ||||| |||||| | |    
50371975 ggcaaggagctccttctaaggatgtatctgaaaaatagcgtgttcgattttcaggaagaacaacgcttggccagtacgcatgcttctacgcacaagccgg 50371876  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | |||  ||||||||||||||||||||||||||||    
50371875 attagtcgcccatctttggtggatcggaaaccggtgcgaaag 50371834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 135 - 231
Target Start/End: Complemental strand, 17092576 - 17092480
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcga 231  Q
    ||||||||| |||||||||||   |||||||||| | |||||||||| ||| || | ||||||| |||||| |||||| |||| |||||||||||||    
17092576 ttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcgtccacctttggtagatcagaaaccggtgcga 17092480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 213
Target Start/End: Original strand, 31152683 - 31152803
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||||||| | |||||||| | | ||||||||   |||| || ||  ||||| |||||||| ||||||||||||| |||||     
31152683 ggcaaggagctctttccaaggatgtacccagggaataccgggttcgatttcccgggggaataacgcttggtcagtgcgcgtgcctctacacacgagtcaa 31152782  T
193 attagttgtccacttttggtg 213  Q
    |||||| |||||| |||||||    
31152783 attagtcgtccacctttggtg 31152803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 93 - 236
Target Start/End: Original strand, 5855489 - 5855632
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||||   ||||||| | | |||||||   ||| | |||||  |||||||||||||||||||||||| ||  || | |    
5855489 ggcaaggagctccttccaaggacgtattcggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcgg 5855588  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    |||||| || ||| ||| |||| |||||||||| ||||||||||    
5855589 attagtcgttcacctttagtgggtcggaaaccgatgcgaaagct 5855632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 2981072 - 2980930
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| || ||| |||||  |||||||   | |||||||   || || |||||  ||||||||||| |||||||||||| ||| |||| |    
2981072 ggcaaggagctccttccagggacgtatccggggaatactgggttcgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcgg 2980973  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||  ||| |||| ||||||| ||||||||||||    
2980972 attagtcgtccatgtttagtgggtcggaaatcggtgcgaaagc 2980930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 165 - 235
Target Start/End: Original strand, 6899597 - 6899667
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||| ||| |||||| | ||||||| | |||| |||| ||||||||||||||||||||||||    
6899597 agtgcgcatgcctttacgcacaagccggattagtcgcccacctttgatggatcggaaaccggtgcgaaagc 6899667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 9853418 - 9853276
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||||||| |  |  |||| | | |||||||  ||||||||||||   ||  ||||||||||||||||||||||| |  |||    
9853418 ggcaaggagctccttccaaggatgtacccggaaaataccgggttcgattcctaggggaaacaacgttttaccagtgcgcatgcctctacacacgaaccag 9853319  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |||||| |||||||| || |||| |||||| |||||    
9853318 attaatcgtccacctttggtgggtcagaaatcggtgcaaaagc 9853276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 15238247 - 15238105
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |||||||||| | | |||||||   ||||| | |||  |||||||| || |||||||||||| ||| | |||     
15238247 ggcaaggagctccttccaaggacgtacctagggaatatcgggttcgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcat 15238148  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||| |||||||| | |||||||||| |||||||    
15238147 attagtcgctcacctttggtgggttggaaaccggttcgaaagc 15238105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 101 - 235
Target Start/End: Original strand, 15465940 - 15466074
Alignment:
101 gctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttg 200  Q
    ||||||| |||||| |||| | ||||||| ||| ||||||||  ||||| |||||  ||||| |||||| ||||||||||| ||| |||| |||| || |    
15465940 gctccttccaaggacgtatttggggaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcg 15466039  T
201 tccacttttggtggatcggaaaccggtgcgaaagc 235  Q
      ||| |||||||| |||||||||| | |||||||    
15466040 ctcacctttggtgggtcggaaaccgatacgaaagc 15466074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 34697302 - 34697444
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||  | ||||   ||||||| ||| ||||||| ||||||| |||||  |||||| |||| |||||||||||| ||  || | |    
34697302 ggcaaggagctccttccaaaaacgtattcggggaataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagccgg 34697401  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | ||||||||| ||| | |||||||| |||||||||    
34697402 attagtcgcccacttttgatgggttggaaaccgatgcgaaagc 34697444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 195
Target Start/End: Original strand, 34877957 - 34878059
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||| |||| |||||| ||||   ||||||| ||| |||||||  |||| | |||||  |||||||||||||||||||||||||||| || |||    
34877957 ggcaaggagcaccttccaaggacgtattcggggaataccaggttcgattcctaggcggaacaacacttggccagtgcgcatgcctctacacacgagccag 34878056  T
193 att 195  Q
    |||    
34878057 att 34878059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 235
Target Start/End: Complemental strand, 50503498 - 50503360
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    |||||||||||||||||| |||||  ||||||| | | |||||||   ||||| |||||  |||| ||||||||||||||||||| ||| || | ||||     
50503498 aggagctcctttcaaggacgtatccggggaatatcgggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgcacgagccggattt 50503399  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    || | ||||   |||||| |||||||||| |||||||||    
50503398 gtcgcccaccaatggtgggtcggaaaccgatgcgaaagc 50503360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 5503998 - 5504139
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| | || | |||||| ||||||| ||| ||||||| | |||| ||||||  ||||   ||||| ||||||||||| ||  || | |    
5503998 ggcaaggagctccttccgagaacgtatctggggaatatcaggttcgattctcagggaaaacaacgcttgattagtgcacatgcctctacgcatgagccgg 5504097  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||| ||| |||||||||||| ||||||    
5504098 attagtcgtccacctttgatgggtcggaaaccggtacgaaag 5504139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 37339852 - 37339929
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||| || ||| || | ||||||| | |||| |||||||| | ||||||||||||||||||    
37339852 cttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc 37339929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 46929814 - 46929737
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||| |||||||||||| |||||  || | ||||||| ||||||||||| ||||||| |||||| |||||||||    
46929814 cttggccaatgcgcatgcctccacacatgagccggattagtcgtccacttttgatggatcgaaaaccgatgcgaaagc 46929737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 225
Target Start/End: Original strand, 10336483 - 10336615
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || |||||  | ||||| | | ||||||||| ||||| |||||  |||| ||||||||||||||||||| ||  || | |    
10336483 ggcaaggagctccttccaaagacgtatccggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccgg 10336582  T
193 attagttgtccacttttggtggatcggaaaccg 225  Q
    |||| | |||||| |||| ||||||| ||||||    
10336583 attaatcgtccacctttgatggatcgaaaaccg 10336615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 93 - 224
Target Start/End: Complemental strand, 33418256 - 33418125
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || ||| |  | ||||| | |||||||||  ||||||  ||||  |||||||||||||||||||||||  ||| || | |    
33418256 ggcaaggagctccttccaaagacgtacccggagaataccggattcgattcctaggggggacaacgcttggccagtgcgcatgcctctatgcacgagccgg 33418157  T
193 attagttgtccacttttggtggatcggaaacc 224  Q
    |||||| |||||| |||||| | |||||||||    
33418156 attagtcgtccacctttggtcggtcggaaacc 33418125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 118 - 235
Target Start/End: Original strand, 35908749 - 35908865
Alignment:
118 atctagggaataacagattcgatttttaggggaaacaattc-ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggat 216  Q
    |||||||||||| | ||||||||||||||||| |||||  | |||| |||||||||||||||||| ||  || | ||||||| ||||||  |  |||| |    
35908749 atctagggaataccggattcgatttttagggggaacaacactttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccat--gtgggt 35908846  T
217 cggaaaccggtgcgaaagc 235  Q
    ||||||||||||| |||||    
35908847 cggaaaccggtgcaaaagc 35908865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 18915834 - 18915976
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| ||| |||||| ||| |  ||||||| | | |||||||   ||||| |||||  ||||||||||| |||||||||||| ||| || | |    
18915834 ggcaaggagcttcttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccgg 18915933  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  |||  ||||||| | ||||||||||||||||||    
18915934 attagtcgctcaccattggtgggttggaaaccggtgcgaaagc 18915976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 33498980 - 33498838
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| |||||| ||||||||| || |  |||| | | ||||||| | ||| | | |||  |||||||||||||||||||||||| ||  || | |    
33498980 ggcaaggagttccttttaaggatgtacctggaaaataccgggttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatgagccgg 33498881  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||| ||||||| ||| |||| |||||||    
33498880 attagtcgtccacctttgatggatcgtaaagcggtacgaaagc 33498838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 10173047 - 10172970
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||| ||||||||||| ||  || | ||||| | | |||| |||||||| ||||||||||||||||||||    
10173047 cttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaagc 10172970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 12744655 - 12744576
Alignment:
102 ctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||| |||||| ||||||  |||||| ||||||||||||| ||||| |||||  |||| | |||||||||| ||||||    
12744655 ctccttccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctac 12744576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 12755645 - 12755566
Alignment:
102 ctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    |||||| |||||| ||||||  |||||| ||||||||||||| ||||| |||||  |||| | |||||||||| ||||||    
12755645 ctccttccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctac 12755566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 198
Target Start/End: Complemental strand, 18708639 - 18708576
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    ||||||||  ||||||| |||| |||||| ||||||||||||||||||||  || |||||||||    
18708639 ttcgatttccaggggaagcaatgcttggctagtgcgcatgcctctacacatgagccagattagt 18708576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 165 - 235
Target Start/End: Complemental strand, 9659248 - 9659178
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||| ||| ||  || | ||||||| |||||| |||||||| | ||||||||||||||||||    
9659248 agtgcgcatgcctttacgcatgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaagc 9659178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 16956433 - 16956575
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| |   |||| || | ||||| |||||   ||| ||||||||||||||||||| ||| || | |    
16956433 ggcaaggagctccttccaaggacgtacccggggaataccgtgttcggttctcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccgg 16956532  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||    ||| |||||||| ||||||||| ||||||||||    
16956533 attagtcactcacctttggtgggtcggaaaccagtgcgaaagc 16956575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 17389739 - 17389880
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||||||| || || ||  || |||| | |||||||||||  |||||| ||||  ||| |||||||||||||||| || ||  ||   |    
17389739 ggcaaggagctcctttcaatgacgtttccgggaaatatcggattcgattttcgggggaa-caatgtttgaccagtgcgcatgcctccacgcatgagctgg 17389837  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||| |  || ||| ||||||||||||||||||||    
17389838 attagtcgtccattgctgatgggtcggaaaccggtgcgaaagc 17389880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 25178652 - 25178575
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||| |||||||| ||||| | ||||||| || ||| ||| |||| ||| |||||| | |||||||    
25178652 cttggccagtgcgcatacctctacagacaagccggattagtcgttcacctttagtgggtcgaaaaccgatacgaaagc 25178575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 198
Target Start/End: Complemental strand, 40226383 - 40226278
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||||     ||||| || |||||||| | || || |||||  ||||| ||||  |||||||||||| ||||||||||    
40226383 ggcaaggagctccttccaaggacgtattcgaagaatatcatattcgattatcagaggtaacaacgcttggtcagtatgcatgcctctacgcacaagtcag 40226284  T
193 attagt 198  Q
    ||||||    
40226283 attagt 40226278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 44969696 - 44969773
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| ||||||| |||| ||  || | ||||||| |||||   ||||||||||||||||||||| ||||||    
44969696 cttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaagc 44969773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Complemental strand, 21849281 - 21849205
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| ||||||||||||||||| ||| || | ||||||| |  |||| ||||||| ||| |||||||| ||||||    
21849281 cttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacgaaag 21849205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 32142945 - 32142845
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||| ||||| |||||  |||||||||||||||||||| ||| ||  || |  |||||| |  ||| |||| ||| |||||||||| ||||||||    
32142945 ttcgattttcagggggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 32142846  T
235 c 235  Q
    |    
32142845 c 32142845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Complemental strand, 48798211 - 48798123
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| ||| || |||||  ||||||| | | ||||||||  ||||| |||||  |||| | |||||||||||||||||    
48798211 ggcaaggagctccttccaatgacgtatccggggaatatcgggttcgatttccagggggaacaacgcttgactagtgcgcatgcctctac 48798123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 9e-25; HSPs: 52)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 3136834 - 3136693
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| ||||||||||||||| ||| |  ||||||| | ||||||||||| ||||||| |||  ||||| |||||||||||||||||| ||  |||| |    
3136834 ggcaagaagctcctttcaaggacgtacccggggaataccggattcgattttcaggggaa-caacacttgggcagtgcgcatgcctctacgcatgagtcgg 3136736  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||||| | ||||||||||||||||||||    
3136735 attagtcgtccacctttggttggtcggaaaccggtgcgaaagc 3136693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 94 - 235
Target Start/End: Complemental strand, 26923401 - 26923260
Alignment:
94 gcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcaga 193  Q
    |||||||||||||||||| || |||| || |||||| | |||||||||||||||| ||||||   |||  |||||||||||| | ||||||| |||| ||    
26923401 gcaaggagctcctttcaatgacgtatttaaggaatatcggattcgatttttagggaaaacaacgtttgatcagtgcgcatgcatatacacacgagtcgga 26923302  T
194 ttagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||| ||||||| | ||||||| || |||||||||||||||||    
26923301 ttaattgtccattattggtgggtcagaaaccggtgcgaaagc 26923260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 928566 - 928708
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||| || |||||| ||| |||||||||| ||||||||||| | ||||| |||||  |||| |||||||||||||| |||| ||| || | |    
928566 ggcaaggagctcattccaaggacgtacctagggaataccagattcgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccgg 928665  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||  ||||| |||||||  ||| ||| ||||||||||||    
928666 attagtcatccacctttggtgagtcgaaaatcggtgcgaaagc 928708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 7650193 - 7650335
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||||||||||||||  ||||||||| | | ||||||||  ||||| |||||  |||||||||| || ||| |||||| ||| || | |    
7650193 ggcaaggagttcctttcaaggatgtacttagggaataccgggttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccgg 7650292  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| | ||||||||||||||||||    
7650293 attagtcgcccacctttggtgggttggaaaccggtgcgaaagc 7650335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 13893892 - 13894034
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| || ||  ||||||| | | || |||||  ||||| |||||  ||||| || ||||||||||||||||||| || | |    
13893892 ggcaaggagctccttccaaggacgtgtccggggaataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccgg 13893991  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||||||| ||||||||||||||||    
13893992 attagtcgcccacctttggtggatcgaaaaccggtgcgaaagc 13894034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 48341986 - 48342128
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| || ||||||| | | ||| |||  |||||| |||||  |||||| ||||||||||||||||| ||  |  |||    
48341986 ggcaaggagctccttccaaggacgtacctggggaataccgggttctattcctagggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccag 48342085  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||  ||||||||||||||||| |||||||||||    
48342086 attagtcgtccatctttggtggatcggaaacaggtgcgaaagc 48342128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 30767388 - 30767247
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||||||||| || ||||||| | | ||||||||  ||||| |||||  ||||||||||| |||||||||||| ||| || | |    
30767388 ggcaaggagttccttccaaggatgtacctggggaatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccgg 30767289  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | |||| |||||||| ||||||||  |||||||||    
30767288 attagtcgcccacctttggtgggtcggaaactagtgcgaaag 30767247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 54261192 - 54261333
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| || ||||||| | | |||||||  |||| | |||||  |||||||||||||||||||||||| ||  || | |    
54261192 ggcaaggagctccttccaaggacgtacctggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgg 54261291  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| || ||| ||| |||| |||||||||||||||||||    
54261292 attagtcgttcacctttagtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 15320152 - 15320294
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | ||||||||  ||| | ||||||  |||||||||| |||||||||||| ||| || | |    
15320152 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccgg 15320251  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| || |||||||||||||||||    
15320252 attagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 15320294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 25294926 - 25295068
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | || |||| |  ||||||||||  |||||||||||||||||||||||  ||  || | |    
25294926 ggcaaggagctccttccaaggacgtatccggggaataccgggtttgattctctggggaaacaacacttggccagtgcgcatgcctctatgcatgagccgg 25295025  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| ||||||  ||||||| | ||||||||||||||||||    
25295026 attagtcgtccaccattggtgggttggaaaccggtgcgaaagc 25295068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 29127885 - 29128027
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| ||||| |||||| |||||| ||||||| | | ||||||||  ||||  |||||  ||||| |||||||||||||||||| ||  || | |    
29127885 ggcaaggagatccttccaaggacgtatctggggaatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccgg 29127984  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| |||||||||| |||||||||    
29127985 attagtcgcccacctttggtgggtcggaaaccgatgcgaaagc 29128027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 31072844 - 31072986
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||||||||| ||| |  | ||||| ||| ||||||||  ||||| |||||  ||||| |||||| ||||||||||| ||| |  |||    
31072844 ggcaaggagctcctttcaaggacgtacccggagaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccag 31072943  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| | |||||| |||||| | | ||||||||||||||||||    
31072944 attaatcgtccacctttggtaggttggaaaccggtgcgaaagc 31072986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 29762296 - 29762155
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||||||||   ||||||| | | | ||||| | ||||| |||||  |||||||||||||||||||||||  ||  ||   |    
29762296 ggcaaggagctccttccaaggatgtattcggggaatatcgggtccgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctgg 29762197  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| ||||||  ||||||| |||||||||||||||||||    
29762196 attagtcgtccaccattggtgggtcggaaaccggtgcgaaag 29762155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 45877420 - 45877561
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||| |||| |||||| |||||  ||||||| | | ||||||||  |||||||||||  |||||||||||| ||||||||||| ||  || | |    
45877420 ggcaaggagccccttccaaggacgtatccggggaataccgggttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccgg 45877519  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| || |||  ||| ||| |||||||||||||||||||    
45877520 attagtcgttcaccattgatgggtcggaaaccggtgcgaaag 45877561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 235
Target Start/End: Original strand, 47219116 - 47219252
Alignment:
99 gagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    |||||| || |||||| |||||  ||||||| ||| |||||||   | |||||||||  |||||| ||||||||||||||||| ||  || | |||||||    
47219116 gagctctttccaaggacgtatccggggaataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagt 47219215  T
199 tgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
     |||||| |||| ||| ||||||||||||||||||||    
47219216 cgtccacctttgatgggtcggaaaccggtgcgaaagc 47219252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 99 - 235
Target Start/End: Complemental strand, 47749239 - 47749104
Alignment:
99 gagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagt 198  Q
    ||||| ||| |||||| ||||| |||||||| | | |||||||  |||||||| ||| ||||||||||||||||||||||||| ||| || |  ||||||    
47749239 gagcttcttccaaggacgtatccagggaataccgggttcgattcctaggggaa-caactcttggccagtgcgcatgcctctacgcacgagccgaattagt 47749141  T
199 tgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
     | |||| |||||| | |||||||||| |||||||||    
47749140 cgcccacctttggtaggtcggaaaccgatgcgaaagc 47749104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 28572300 - 28572210
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||  ||||||||||  |||||||||||| ||| || | ||||||| | |||| |||||||| ||||||||||||||||||||    
28572300 aggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 28572210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 29135879 - 29136021
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||| ||| |||||| |||||  ||||||| | |||||||||   ||||| |||||  |||||||||||||||||||||||| ||  || | |    
29135879 ggcaaggagcttcttccaaggacgtatccggggaataccggattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 29135978  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||  |||||  ||||||| | |||||||||| |||||||    
29135979 attagtcttccaccattggtgggttggaaaccggtacgaaagc 29136021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 187
Target Start/End: Complemental strand, 46530011 - 46529917
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaa 187  Q
    |||||||||||||||||||||| ||| || ||||||| | | ||||||| | || ||||||||| ||| ||||||| ||||||||||| ||||||    
46530011 ggcaaggagctcctttcaaggacgtacctggggaataccgggttcgattctcagaggaaacaatgcttcgccagtgtgcatgcctctatacacaa 46529917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 47471798 - 47471938
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||||||| |||||| ||| |||||||||| | | |||||||   ||||||| |||| |||||| ||||||||||| ||||| ||  || |      
47471798 ggcaaagagctccttccaaggacgtacctagggaataccgggttcgattcccaggggaa-caatgcttggctagtgcgcatgcttctacgcatgagccga 47471896  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||||| |||||||| |||||||||| ||||||||    
47471897 attagtcgtccacctttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 93 - 233
Target Start/End: Original strand, 6462378 - 6462518
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||| ||||||| | | |||||||   ||||  |||||  |||||||||||||||||||||||| ||  || | |    
6462378 ggcaaggagctccttccaaggacgtatctggggaataccgggttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccgg 6462477  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||| | ||| | || |||| | ||||||||||||||||    
6462478 attagtcgaccattattagtgggttggaaaccggtgcgaaa 6462518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 145 - 229
Target Start/End: Complemental strand, 50405692 - 50405608
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgc 229  Q
    |||||||||||  |||| ||||||||||||||||||| ||| |||| ||||||| | ||||  ||||||| ||||||||||||||    
50405692 aggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgc 50405608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 158 - 233
Target Start/End: Complemental strand, 3507609 - 3507534
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    |||||||||||||||||||||||| ||| || | ||||||| |  ||| |||||||| ||||||||||||||||||    
3507609 cttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 100 - 235
Target Start/End: Complemental strand, 51060415 - 51060280
Alignment:
100 agctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagtt 199  Q
    |||||||| ||||||| ||||  ||||||| | | ||||||| | ||||| |||||  ||||| |||||||||||||||||| ||  |    |||||||     
51060415 agctccttccaaggatctatccggggaatatcgggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtc 51060316  T
200 gtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||  ||||||| ||||||||||||||||||||    
51060315 gtccaccattggtgggtcggaaaccggtgcgaaagc 51060280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 30045787 - 30045929
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| |||||||||| ||| | |||  | ||||||| | | |||||||  |||||| |||||  ||||||||||||||||| |||||| ||| |||| |    
30045787 ggcaatgagctccttttaagaacgtacatggggaataccgggttcgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctg 30045886  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| |||| ||| ||| ||||  ||||||||||    
30045887 attagtcgtccacctttgatgggtcgtaaactagtgcgaaagc 30045929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 8164584 - 8164661
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||| ||| ||| |||| ||||||| | |||| |||||||||||||||| ||| | ||||||    
8164584 cttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtggatcggaaatcggcgtgaaagc 8164661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 93 - 230
Target Start/End: Original strand, 10040523 - 10040659
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||||||||||||  ||||| ||| |  ||||||| | | ||||||| | ||||||| |||  |||||||||||||||||||||||| ||| || | |    
10040523 ggcaaggagctccttctaaggacgtacccggggaatatcgggttcgattctcaggggaa-caacgcttggccagtgcgcatgcctctacgcacgagccgg 10040621  T
193 attagttgtccacttttggtggatcggaaaccggtgcg 230  Q
    | | || |||||| |||||||| | |||||||||||||    
10040622 aatggtcgtccacctttggtgggttggaaaccggtgcg 10040659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 145 - 234
Target Start/End: Original strand, 35315974 - 35316063
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||| |||||  |||||||||||||||||||||||| ||  ||   ||||||| | ||||||||||||| |||||||||| ||||||||    
35315974 agggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 229
Target Start/End: Complemental strand, 35923764 - 35923628
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| |||||| || |||||| ||| || | ||||| ||| |||||||  |||||| |||||   ||||||||||||||||||||||  ||| ||||      
35923764 ggcaatgagctcattccaaggacgtacctggagaataccaggttcgattcatagggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcga 35923665  T
193 attagttgtccacttttggtggatcggaaaccggtgc 229  Q
    |||||| |||||  |||| ||||||| ||||||||||    
35923664 attagtcgtccatctttgatggatcgaaaaccggtgc 35923628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 163 - 235
Target Start/End: Complemental strand, 49021274 - 49021202
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||| ||  || | ||||||| ||||||  ||||||| ||||||||||||||||||||    
49021274 ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 49021202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 97 - 233
Target Start/End: Complemental strand, 51683091 - 51682955
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    ||||||||||| ||| || |||||  ||||||| ||| |||||||   ||||| |||||  |||| ||||||||||||||||| ||||| || | |||||    
51683091 aggagctccttccaaagacgtatccggggaataccaggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggatta 51682992  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    || | ||||   |||||| ||||||||| ||||||||    
51682991 gtcgcccaccaatggtgggtcggaaaccagtgcgaaa 51682955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 97 - 233
Target Start/End: Original strand, 53649697 - 53649833
Alignment:
97 aggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatta 196  Q
    ||||||||||| |||||| ||||   ||||||| | | ||||||| | ||||  |||||  |||||||||||||| || |||||| ||  || | |||||    
53649697 aggagctccttccaaggacgtattcggggaataccgggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggatta 53649796  T
197 gttgtccacttttggtggatcggaaaccggtgcgaaa 233  Q
    || || ||| |||| ||||||||||||||||||||||    
53649797 gtcgttcacctttgatggatcggaaaccggtgcgaaa 53649833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 93 - 232
Target Start/End: Original strand, 4638120 - 4638259
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||| |||||| ||||| |||||| || ||||| || |||||||   ||| |||||||  |||| ||||||||||| ||||||| ||| || | |    
4638120 ggcaaggagttccttttaaggacgtatcttggaaataataggttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccgg 4638219  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    |||||| | |||| |||  ||| |||||||||| ||||||    
4638220 attagtagcccacctttaatgggtcggaaaccgatgcgaa 4638259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 131 - 234
Target Start/End: Original strand, 19146965 - 19147068
Alignment:
131 cagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcg 230  Q
    ||||||||||||| ||| | |||||  ||||||||||| | || ||||||  ||| ||   ||||||| |||||| |||||||| |||||||||||||||    
19146965 cagattcgattttcaggaggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcg 19147064  T
231 aaag 234  Q
    ||||    
19147065 aaag 19147068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 151 - 234
Target Start/End: Complemental strand, 45450530 - 45450447
Alignment:
151 aacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| |||| ||||||||||||||||||| || |||  |||||||| |||||| |||| ||  | |||||||||||||||||    
45450530 aacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaaag 45450447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 34374531 - 34374441
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||  ||||| ||||||||||||||| || || ||||| ||||||| | ||   |||||||| ||||||||||||| ||||||    
34374531 aggggaaacaacacttggtcagtgcgcatgcctcaacgcataagtcggattagtcgcccttctttggtgggtcggaaaccggtgtgaaagc 34374441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 49198359 - 49198449
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccg 225  Q
    |||||||  |||||| |||||  |||||||||||||||||||||||| ||  || | ||||||| ||||||  |||||||||| |||||||    
49198359 ttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcagaaaccg 49198449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 159 - 232
Target Start/End: Original strand, 8362609 - 8362682
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaa 232  Q
    ||||||||| ||||||||||||| ||  || || |||||| |||||| ||| ||||||| ||||||||||||||    
8362609 ttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccggtgcgaa 8362682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 93 - 198
Target Start/End: Complemental strand, 11687250 - 11687145
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    |||||| |||||||| |||||| ||| || | ||||| | | || |||| | ||||| |||||| ||||||||||||||||||||||||  |  ||||||    
11687250 ggcaagaagctccttccaaggacgtacctggagaataccgggtttgattctcagggggaacaatgcttggccagtgcgcatgcctctacgtatgagtcag 11687151  T
193 attagt 198  Q
    ||||||    
11687150 attagt 11687145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 163 - 235
Target Start/End: Original strand, 23511603 - 23511675
Alignment:
163 ccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||| ||  |||| ||||| | |||||| |||| ||| ||| ||||||||||||||||    
23511603 ccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcgaaagc 23511675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 147 - 235
Target Start/End: Complemental strand, 24506735 - 24506647
Alignment:
147 gggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||  |||| ||||||| ||||||||||| ||  |||||||||||| |  |||  ||||||| |||||||||||||| |||||    
24506735 gggaaacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc 24506647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 26590365 - 26590265
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||| | ||||| |||||  ||||| ||||| |||||||||||||||| ||  |||||| | |  |   ||||||||||||||||||||||||||||    
26590365 ttcgattctcagggggaacaacgcttggtcagtgtgcatgcctctacacacgagctagattaatcgatcgtatttggtggatcggaaaccggtgcgaaag 26590266  T
235 c 235  Q
    |    
26590265 c 26590265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 147 - 235
Target Start/End: Complemental strand, 43330819 - 43330731
Alignment:
147 gggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||  |||| ||||||||||||||||||| ||| || | ||||||| | |||| |||||||| ||  |||||||| |||||||    
43330819 gggaaacaacacttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtacgaaagc 43330731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 145 - 236
Target Start/End: Original strand, 7328862 - 7328952
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||| |||||  |||||||||||||||||||| ||| ||  || | ||||||| | |||| |||||||| ||| |||||||||||||||||    
7328862 agggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagct 7328952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 165 - 235
Target Start/End: Complemental strand, 15285802 - 15285732
Alignment:
165 agtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||| ||||  ||||||| || ||| |||| |||||| |||| ||||| ||||||    
15285802 agtgcgcatgcctctacacataagttggattagtcgttcacctttgatggatcagaaatcggtgagaaagc 15285732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 231
Target Start/End: Complemental strand, 26207942 - 26207804
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||||||| |  ||||||| | | |||||||   | ||| |||||  |||| |||||| |||||||||||| ||  || | |    
26207942 ggcaaggagctccttccaaggatgtacccggggaataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccgg 26207843  T
193 attagttgtccacttttggtggatcggaaaccggtgcga 231  Q
    |||||| | ||| | || |||| ||||||||||||||||    
26207842 attagtcggccattattagtgggtcggaaaccggtgcga 26207804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 49543485 - 49543627
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | ||||||| | | ||| |||||   |||| ||||| |||||||||||| ||| || |      
49543485 ggcaaggagctccttccaaggacgtatcccgggaatatcgggttcgattctcatggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccga 49543584  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| ||| |||| |||||||| ||| |||||||    
49543585 attagtcgcccacctttagtgggtcggaaactggtacgaaagc 49543627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 41630588 - 41630511
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||||||  || | ||||||| | |||| |||||| | |||||||| |||| ||||||    
41630588 cttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggttggtcggaaactggtgtgaaagc 41630511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 181
Target Start/End: Original strand, 10855350 - 10855438
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctac 181  Q
    ||||||||||||||| ||||||||||  | || |||| | | || |||||  ||||| |||||  |||||||||| |||||||||||||    
10855350 ggcaaggagctccttccaaggatgtacttgggaaataccgggtttgatttccagggggaacaacgcttggccagtacgcatgcctctac 10855438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 15085020 - 15084944
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||| |||| |||||||  || ||  |||||||| ||| |  |||||||||||||||||||||| ||||||    
15085020 ttggccagtgtgcatacctctacgtacgagctagattagtcgtctatctttggtggatcggaaaccggtgtgaaagc 15084944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 147 - 235
Target Start/End: Complemental strand, 35998658 - 35998570
Alignment:
147 gggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||  ||||  |||||| ||||||||||| ||| |||  ||||| | |||||| ||| |||| || |||||||||||||||||    
35998658 gggaaacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcgaaagc 35998570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 235
Target Start/End: Complemental strand, 55069754 - 55069678
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||| ||||||||||| ||| || | ||||| | |  ||| |||||||| |||||||||||||| |||||    
55069754 ttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgcaaaagc 55069678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 95 - 224
Target Start/End: Original strand, 9816 - 9945
Alignment:
95 caaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagat 194  Q
    ||||||||||||| |||||||||||||  |||||| | ||||||||||  ||||| |||||  |||||||||||||||||||||||| ||| || | |||    
9816 caaggagctccttccaaggatgtatctgaggaataccggattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggat 9915  T
195 tagttgtccacttttggtggatcggaaacc 224  Q
    |||| |||||| |||||||| || ||||||    
9916 tagtcgtccacctttggtgggtcagaaacc 9945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 93 - 234
Target Start/End: Complemental strand, 42972 - 42831
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||| ||||| ||| |||| ||||| || ||||||| | | |||||||  |||||  |||||| ||||| |||||||||||||||||||||  || | |    
42972 ggcaacgagctacttccaagaatgtacctggggaatatcgggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccgg 42873  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| | |||| |||||||| |||||||||||||||||||    
42872 attagtcgcccacctttggtgggtcggaaaccggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 319391 - 319533
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| |||||  ||||||| | | || ||||| |||||| |||||  |||||||||||||||| ||||||  ||  ||   |    
319391 ggcaaggagctccttccaaggacgtatccggggaataccgggtttgatttctagggggaacaacgcttggccagtgcgcatccctctatgcatgagctgg 319490  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |||||| ||||||||  |||||||||||||||||||    
319491 attagtcgtccacctttggtggggcggaaaccggtgcgaaagc 319533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 539 - 681
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||||| ||| |  ||||||| | | |||||||   ||||| |||||  ||||  ||||| ||||||||||||  |  || |||    
539 ggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccag 638  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| |  ||| |||||||| ||||||||||||||||||||    
639 attagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 1754 - 1612
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| ||| || ||  || ||||||| ||| ||||||||  ||||| |||||   || |||||||||||||||||||| ||  || ||     
1754 ggcaaggagctccttccaatgacgtgcctggggaataccaggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaa 1655  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||| |||||||| ||| ||||||||||||||||    
1654 attagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc 1612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 145 - 235
Target Start/End: Original strand, 6876 - 6966
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||||||||||||||||||||| ||  || | ||||||| |  ||| |||||||| ||||||||||||||||||||    
6876 agggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 6966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 145 - 235
Target Start/End: Complemental strand, 155799 - 155709
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||| |||||  |||||| ||||||||||||||||| ||| || | ||||||| | |||| |||||||| |||||| |||||||||||||    
155799 agggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaagc 155709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 7910 - 7833
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||||||||||||||||||||| ||  ||   ||||||| | |||| ||||||||||||||||||||| |||||||    
7910 cttggccagtgcgcatgcctctacgcattagctggattagtcgcccacctttggtggatcggaaaccggtacgaaagc 7833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 95119 - 94978
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| |||| | |||||  ||||||| ||| |||||||| ||  ||||||||   ||| ||||||||||||||| ||| ||  || | |    
95119 ggcaaggagctccttccaagaaagtatccggggaataccaggttcgatttcta--ggaaacaacgtttgaccagtgcgcatgcctttacgcatgagccgg 95022  T
193 attagttgtcca-cttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | ||| | |||||||| ||||||| |||||| |||||    
95021 attagtcgcccaccatttggtgggtcggaaatcggtgcaaaagc 94978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 159 - 234
Target Start/End: Original strand, 25120 - 25195
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||| |||||||||||  ||||| ||  | |||||||| | |||||| ||||||||||||||||||||||||||||    
25120 ttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag 25195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 145 - 236
Target Start/End: Complemental strand, 8789 - 8698
Alignment:
145 aggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||| |||||  |||||||||||||| ||||||||| ||  ||   ||||||| |||||| |||||||| |||||||| ||||||||||||    
8789 agggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagct 8698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 234
Target Start/End: Original strand, 16851 - 16989
Alignment:
96 aaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagatt 195  Q
    |||||||||||| |||||||| ||  ||||||||   | ||| ||| | |||||||||||  ||||| ||||||| ||| |||||| ||| || ||||||    
16851 aaggagctccttccaaggatgcattcagggaatattgggttcaattctcaggggaaacaacgcttggtcagtgcgtatgtctctacgcacgagccagatt 16950  T
196 agttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||| |  ||| |||||||| | |||||||| ||||||||    
16951 agtcgctcacctttggtgggttggaaaccgatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 12607 - 12684
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||| ||||||||||||||||||| ||  |||| ||||||| | |||| |||| |||||  |||||||||||||||||    
12607 cttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc 12684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 133 - 225
Target Start/End: Original strand, 17399 - 17491
Alignment:
133 gattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccg 225  Q
    ||||||||| | |||||||| ||| |||| ||||||||||||| ||||||||| || | ||||||| | ||||  ||| ||| ||||||||||    
17399 gattcgattctcaggggaaaaaatgcttgaccagtgcgcatgcttctacacacgagccggattagtcgcccaccattgatgggtcggaaaccg 17491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 235
Target Start/End: Original strand, 219404 - 219480
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    ||||||||||||||||||||||| ||| |    ||||||| |||||| |||| ||||||| |||||||||| |||||    
219404 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 219480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 159 - 234
Target Start/End: Complemental strand, 250099 - 250024
Alignment:
159 ttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||||||||||||||| ||| || | ||||||| |  | | |||||||| ||||||| |||||||||||    
250099 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 250024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 234
Target Start/End: Original strand, 26194 - 26293
Alignment:
135 ttcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||  ||||| |||||  ||||||||||| |||||||||||| ||| || | ||||||| ||||||  ||| ||  ||||||||| |||||||||    
26194 ttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaaag 26293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 93 - 235
Target Start/End: Original strand, 41013 - 41155
Alignment:
93 ggcaaggagctcctttcaaggatgtatctagggaataacagattcgatttttaggggaaacaattcttggccagtgcgcatgcctctacacacaagtcag 192  Q
    ||||||||||||||| || ||| |||   |||||||| | | ||||||| | | ||| |||||  ||||| ||||| |||||||||||| ||| || | |    
41013 ggcaaggagctccttccatggacgtactcagggaatatcgggttcgattctcaaggggaacaacacttggtcagtgtgcatgcctctacgcacgagccgg 41112  T
193 attagttgtccacttttggtggatcggaaaccggtgcgaaagc 235  Q
    |||||| | |||  |||||||  |||||||||||| |||||||    
41113 attagtcgcccatctttggtgagtcggaaaccggttcgaaagc 41155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 164 - 234
Target Start/End: Original strand, 224357 - 224427
Alignment:
164 cagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    |||||| ||| ||||||| ||| || | ||||||| |||||  |||||||| |||||||||||||||||||    
224357 cagtgcacatacctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 158 - 236
Target Start/End: Complemental strand, 65227 - 65149
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaagct 236  Q
    ||||||||||||||||| |||||| ||  ||   ||||||| |  |||||||| | |||||||||||||||||||||||    
65227 cttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaagct 65149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 166 - 231
Target Start/End: Original strand, 68556 - 68621
Alignment:
166 gtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcga 231  Q
    |||||||||||||||| ||| || | ||||||| | |||| |||||||| ||| ||||||||||||    
68556 gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 68621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 158 - 234
Target Start/End: Original strand, 12704 - 12780
Alignment:
158 cttggccagtgcgcatgcctctacacacaagtcagattagttgtccacttttggtggatcggaaaccggtgcgaaag 234  Q
    ||||||||||| |||||||||||| ||| |  | ||||||| | |||| |||| ||| || ||||||||||||||||    
12704 cttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University