View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_high_53 (Length: 255)
Name: NF18947_high_53
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 33728617 - 33728414
Alignment:
| Q |
1 |
ctctgaacctcctcttcagtcggaagcacggatatgttactagttttttccgtaataacggaagagtccatttgacataacgtggggacataaaggtcat |
100 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728617 |
ctctgaacctcctcttcagttggatgcacggatatgttgctagttttctccgtaataacggaagagtccatttgacataacgtggggacataaaggtcat |
33728518 |
T |
 |
| Q |
101 |
tgcaaccactaaaattcatcattccttgagtttgaccttcttgaaaccctgttactgtgttcaaaatcgatgatgaattagaccaatccatgaaattgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33728517 |
tgcaaccactaaaattcatcattccttgagtttgaccttcttgaaaccctgttactgtgttcaaaatcgatgatgaattagaccaatccatgaaattgtt |
33728418 |
T |
 |
| Q |
201 |
attt |
204 |
Q |
| |
|
|||| |
|
|
| T |
33728417 |
attt |
33728414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University