View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_high_54 (Length: 253)
Name: NF18947_high_54
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 238
Target Start/End: Original strand, 33728627 - 33728863
Alignment:
| Q |
2 |
agcaaaccaagttgagaattcgtctggattttttcaacgtggttcaaatgattttactcaaggaatgggatacgctaatccggttgacccatttgggttt |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33728627 |
agcaaaccaagtcgagaattcgtctgggttttttcaacgcggttcaaatgattttactcaaggaatgggatacgctaatccggttgacccgtttgggttt |
33728726 |
T |
 |
| Q |
102 |
aggtacccggttcaaccggttggatttggattccaacaatgaaccggataggaagttagaagnnnnnnntttgttatttgtaatagtcaatatgcatgtg |
201 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33728727 |
agatacccagttcaaccggttggatttggattccaacaatgaaccggataggaagttagaagaaaaaaatttgttatttgtaatagtcaatatgcatgtg |
33728826 |
T |
 |
| Q |
202 |
gtgtaaataggtcgggattcttttggcctaacaaaat |
238 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33728827 |
gtgtaaataggtggggattcttttggcctaacaaaat |
33728863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University