View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_high_61 (Length: 248)
Name: NF18947_high_61
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 3 - 234
Target Start/End: Complemental strand, 3261860 - 3261629
Alignment:
| Q |
3 |
aagctatggcgatgacaccaatgaagggaaatactatctaacattatcttgtgtttgttctatcttaattctttttggttgtaattggnnnnnnnnnnaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3261860 |
aagctatggcgatgacaccaatgaagggaaatactatctaacattatcttgtgtttgttctatcttaattctttttggttgtaattggtattttttttaa |
3261761 |
T |
|
| Q |
103 |
tatttttgaaaactttttccttcttgataaacaaaaaggattgtgccatttgagtgataaatcatcattgactttaactctctagaacttgccctaacca |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3261760 |
tatttttgcaaactttttccttcttgataaacaaaaaggattgtgccatttgagtgataaatcatcattgactttgactctctagaacttgccctaacca |
3261661 |
T |
|
| Q |
203 |
ttttgaagctaatttttactcttgaagcatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3261660 |
ttttgaagctaatttttactcttgaagcatgt |
3261629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University