View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_high_62 (Length: 248)
Name: NF18947_high_62
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_high_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 23 - 233
Target Start/End: Complemental strand, 31762655 - 31762449
Alignment:
| Q |
23 |
cggatcaccaaccgccacaaaagctcacggtatatatcatcgctttttccttccattgttttttgtttattggttatggctcaaaacacgnnnnnnnnna |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762655 |
cggatcaccaacagccacaaaagctcacggtatatatcatcgctttttccttccattgttttttgtttattggttatggctcaaaacacgtttttt---- |
31762560 |
T |
|
| Q |
123 |
ttattggttaatatgaagaaacaatagtttttggaaatattttggttttatgttcattggcatgtgttagtgttagatgggatatttgttagggttttat |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762559 |
ttattggttaatatgaagaaaaaatagtttttggaaatattttggttttatgttcattggcatgtgttagtgttagatgggatatttgttagggttttat |
31762460 |
T |
|
| Q |
223 |
gctgctttgat |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
31762459 |
gctgctttgat |
31762449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University