View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_high_65 (Length: 239)
Name: NF18947_high_65
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_high_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 26417015 - 26416792
Alignment:
| Q |
1 |
tcgagtggggttttggtcataggacgaaagcgcatatcacatgtttgtgggttgtgcattttatgacaacatttgagttaatattcgtctttagcttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
26417015 |
tcgagtggggttttggtcataggacgaaagcgcatatcacatgtttgtgggttgtgaattttatgacaacatttgagttcatattcgtctttaacttaat |
26416916 |
T |
 |
| Q |
101 |
atttatacggtggacaagttacctatttctgatcattttaaacaatttacaaatgtagccggtgaatttagaaaaaattggtgttctctacatgtaatta |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26416915 |
atttatacggcggacaagttacctatttctgatcattttaaacaatttacaaatgtagctggtgaatttagaaaaaattggtgttctctacatgtaatta |
26416816 |
T |
 |
| Q |
201 |
gattacggttgtttaggttattta |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26416815 |
gattacggttgtttaggttattta |
26416792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 154
Target Start/End: Complemental strand, 2284162 - 2284124
Alignment:
| Q |
116 |
aagttacctatttctgatcattttaaacaatttacaaat |
154 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
2284162 |
aagttacctatttttgatcattttcaacaatttacaaat |
2284124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University