View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_low_29 (Length: 389)
Name: NF18947_low_29
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 8 - 371
Target Start/End: Original strand, 1187738 - 1188101
Alignment:
| Q |
8 |
tgagatgaatgatggatgaattgcatctagtgacaaatttcaattaaaaatgccaatgccaatgccatgctgaatcgtacgtacacacacattctttgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187738 |
tgagatgaatgatggatgaattgcatctagtgacaaatttcaattaaaaatgccaatgccaatgccatgctgaatcgtacgtacacacacattctttgcc |
1187837 |
T |
 |
| Q |
108 |
gttctggtgttgaattgtgtcatattgtgtgagctagctgtttttatgtccaaattgaaggtttttcatgtgtaagaggcacaactccctctttgcctat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187838 |
gttctggtgttgaattgtgtcatattgtgtgagctagctgtttttatgtccaaattgaaggtttttcatgtgtaagaggcacaactccctctttgcctat |
1187937 |
T |
 |
| Q |
208 |
tcattcctttccttgcagtacaagtacattatgcatgcaatcaatgatttttggtcttattttagttttctacaatcaagtacctacctagataagtcca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187938 |
tcattcctttccttgcagtacaagtacattatgcatgcaatcaatgatttttggtcttattttagttttctacaatcaagtacctacctagataagtcca |
1188037 |
T |
 |
| Q |
308 |
aagtaagacattaattttgctgtcgtattcattcaattctgtttctcaatgattgggatgatcg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
1188038 |
aagtaagacattaattttgctgtcgtattcattcaattcagtttctcgatgattgggatgatcg |
1188101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University