View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_low_64 (Length: 248)
Name: NF18947_low_64
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_low_64 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 2437842 - 2437626
Alignment:
| Q |
1 |
atcgatgtgaactcgagagaaaggatgaaacttcaaaacataagtcacattttttgttctaaagttatgtatcatattacaatcgcaaattaagat---a |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2437842 |
atcgacgtgaactcgagagaaaggatgaaacttcaaaacataagtcacattttttgttctaaagttatgtatcatattacaatcgcaaattaagatgata |
2437743 |
T |
 |
| Q |
98 |
agtatttctattttaatgtgatttggttcggttaccagttgaacaagttttgacctgacctattgttaactttagtttgcttgatgctaaagttacaatt |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
2437742 |
aatatttctattttaatgtgatttggttcggttaccagttgaacaagtcttgacctgacctattgttaactatagtttgcttaatgctaaagttacaatt |
2437643 |
T |
 |
| Q |
198 |
aggccagggaatgccat |
214 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2437642 |
aggccagggaatgccat |
2437626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University