View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_low_67 (Length: 239)
Name: NF18947_low_67
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_low_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 23 - 219
Target Start/End: Complemental strand, 31762655 - 31762463
Alignment:
| Q |
23 |
cggatcaccaaccgccacaaaagctcacggtatatatcatcgctttttccttccattgttttttgtttattggttatggctcaaaacacgnnnnnnnnna |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762655 |
cggatcaccaacagccacaaaagctcacggtatatatcatcgctttttccttccattgttttttgtttattggttatggctcaaaacacgtttttt---- |
31762560 |
T |
 |
| Q |
123 |
ttattggttaatatgaagaaacaatagtttttggaaatattttggttttatgttcattggcatgtgttagtgttagatgggatatttgttagggttt |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31762559 |
ttattggttaatatgaagaaaaaatagtttttggaaatattttggttttatgttcattggcatgtgttagtgttagatgggatatttgttagggttt |
31762463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University