View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_low_73 (Length: 233)
Name: NF18947_low_73
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_low_73 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 45348353 - 45348577
Alignment:
| Q |
9 |
acatcatcacacaaacacgaatagtcaaagttccactcttttgtc-ttttttaaggtcaacgnnnnnnnngcagctgcttgaataattacgttcattgac |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45348353 |
acatcatcacacaaacacgaatagtaaaagttccactcttttgtcgttttttaaggtcaacgttttttt-gcagctgcttgaataattacgttcattgac |
45348451 |
T |
 |
| Q |
108 |
tttgtagaaccaatattctgtatctaaaattttaagcaaaagtaagaccattaacaaaacaaattagaacactcttctgctttcaaaatatacggcagac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45348452 |
tttgtagaaccaatattctgtatctaaaattttaagcaaaactaagaccattaacaaaacaaattagaacactcttctgctttcaaaatatacggcagac |
45348551 |
T |
 |
| Q |
208 |
aaaaatgaaccaaattagaagacttt |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45348552 |
aaaaatgaaccaaattagaagacttt |
45348577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University