View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18947_low_81 (Length: 209)

Name: NF18947_low_81
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18947_low_81
NF18947_low_81
[»] chr6 (1 HSPs)
chr6 (18-46)||(1500547-1500575)


Alignment Details
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 1500575 - 1500547
Alignment:
18 caagcaagaagaggaagggtaattattcg 46  Q
    |||||||||||||||||||||||||||||    
1500575 caagcaagaagaggaagggtaattattcg 1500547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University