View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18947_low_82 (Length: 207)
Name: NF18947_low_82
Description: NF18947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18947_low_82 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 7e-42; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 90 - 189
Target Start/End: Original strand, 3675878 - 3675981
Alignment:
| Q |
90 |
tttgatataagctttatgccaaaaagcatg----ctacaacagatagcagagtgaataaataacctcaaacacctatatagtccctttcccttattaata |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675878 |
tttgatataagctttatgccaaaaagcatgtatgctacaacagatagcagagtgaataaataacctcaaacacctatatagtccctttcccttattaata |
3675977 |
T |
|
| Q |
186 |
agta |
189 |
Q |
| |
|
|||| |
|
|
| T |
3675978 |
agta |
3675981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 91
Target Start/End: Original strand, 3675614 - 3675689
Alignment:
| Q |
16 |
cagaactatacactgcttcttcctttataattacaacacgaatcgattcgggaagatcatggtgaggtgtgttctt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3675614 |
cagaactatacactgcttcttcctttataattacaacacgaatcgattcgggaagatcatggtgagatgtgttctt |
3675689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 3693820 - 3693890
Alignment:
| Q |
18 |
gaactatacactgcttcttcctttataattacaacacgaatcgattcgggaagatcatggtgaggtgtgtt |
88 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
3693820 |
gaaccatacactgcttcttcctttataattacaacacgtatcgattcgggaagatcatgatgaggtgtgtt |
3693890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 91
Target Start/End: Original strand, 3686053 - 3686126
Alignment:
| Q |
18 |
gaactatacactgcttcttcctttataattacaacacgaatcgattcgggaagatcatggtgaggtgtgttctt |
91 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||| | |||||||||||||| |
|
|
| T |
3686053 |
gaactatacacaacttcttcctttataattaccacacgtatcgattcgggaagatcgttatgaggtgtgttctt |
3686126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University