View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18948_high_15 (Length: 375)
Name: NF18948_high_15
Description: NF18948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18948_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 174 - 365
Target Start/End: Complemental strand, 42019313 - 42019122
Alignment:
| Q |
174 |
gtaaaacctctgctttacactttctcaaacattggtggctttcgttagaaaatcgtgttcatcttcatcaatcgtttaaaattcctctctatgatcataa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019313 |
gtaaaacctctgctttacactttctcaaacattggtggctttcgttagaaaatcgtcttcatcttcatcaatcgtttaaaattcctctctatgatcataa |
42019214 |
T |
 |
| Q |
274 |
tttccgggaaaatcaactttaccggaaaattctcacctaccttgattcactaccttccgttcaagatgctgatttcacaaacctgttctctg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019213 |
tttccgggaaaatcaactttaccggaaaattctcacctaccttgattcactaccttccgttcaagatgctgatttcacaaacctgttctctg |
42019122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 50 - 119
Target Start/End: Complemental strand, 42019437 - 42019368
Alignment:
| Q |
50 |
tcttagatcaatatttattattaaattctcaactgaattatgatttggcttggggtcacttccatgacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42019437 |
tcttagatcaatatttattattaaattctcaactgaattatgatttggcttggggtcacttccatgacaa |
42019368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University