View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18948_low_13 (Length: 393)
Name: NF18948_low_13
Description: NF18948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18948_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 42 - 392
Target Start/End: Original strand, 14986432 - 14986787
Alignment:
| Q |
42 |
tccatgtagaagtgatcttgcttatttgggtaatcttggaaaaagatcattttgtatgagattctttggaaccctgatttgctttcatttcgcctttcac |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14986432 |
tccatgtagaagtgatcttgcttatttgggtaatcttggaaaaagatcattttgtatgagattctttggaaccctgatttgctttcatttcgcctttcac |
14986531 |
T |
|
| Q |
142 |
aagggatagtctcaaagtcaaggaaaagagttggttagtatcatcgatacaaactctagttagatgaacggtgattttggtataat-aaaaagagaaata |
240 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
14986532 |
aagggatactctcaaagtcaaggaaaagagttggttagtatcatcgatacaaactctagttagatgaacagtgattttggtataataaaaaagagaaata |
14986631 |
T |
|
| Q |
241 |
ctaaa--gtgtcttaaggcacttgttatttgttaataagacttttagaaaattgtagtgtgactttcaaacatatcttttgtagcaaggtcaatatga-- |
336 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14986632 |
ctaaagtgtgtcttaaggcacttgttctttgttaataaaacttttagaaaattgtagtgtgactttcaaacatatcttttgtagcaaggtcaatatgatt |
14986731 |
T |
|
| Q |
337 |
nnnnnnnnnnnngttgcaaatgtttctctcctcaaaatgcacaagaggatgtttct |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14986732 |
tattttttttttgttgcaaatgtttctctcctcaaaatgcacgagaggatgtttct |
14986787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University