View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18948_low_22 (Length: 285)
Name: NF18948_low_22
Description: NF18948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18948_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 78 - 278
Target Start/End: Original strand, 14986917 - 14987117
Alignment:
| Q |
78 |
tagttagcaagttgtcccaaaaattatcacatattatagctatacaattactcataattaaaacatggacacaagtctaattacaacatggacacaacac |
177 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14986917 |
tagttagtaagttgtcccaaaaattatcacatattatagctatacaattactcataattaaaacatggacacaagtctaattacaacatagacacaacac |
14987016 |
T |
 |
| Q |
178 |
taatgctaactacgtatagatattcaacatatttattaaattttttgtacaattaattaaagttattaacactaataataacattacaaattgaacctat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
14987017 |
taatgctaactacgtatagatattcaacatatttattaaaaaaattgtacaattaattaaagttctttacactaataataacattacaaattgaacctat |
14987116 |
T |
 |
| Q |
278 |
g |
278 |
Q |
| |
|
| |
|
|
| T |
14987117 |
g |
14987117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University