View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18949_low_19 (Length: 237)
Name: NF18949_low_19
Description: NF18949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18949_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 6994309 - 6994530
Alignment:
| Q |
1 |
tgatgatgatgatgcctgagatcttacagg------tccaggtccagctacaattttggaaaagaaaaacaaaagtaatgcaagattatctatacctgca |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994309 |
tgatgatgatgatgcttgagatcttacaggtccaggtccaggtccagctacaattttggaaaagaaaaacaaaagtaatgcaagattatctatacctgca |
6994408 |
T |
|
| Q |
95 |
ttaattagatgattaatgatatttagtacataccatctgattgacgatcttctgcataggaatttcctgcatcagaagtattggtttgcattgaagaagg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994409 |
ttaattagatgattaatgatatttagtacataccatctgattgacgatcctctgcataggaatttcctgcatcagaagtattggtttgcattgaagaagg |
6994508 |
T |
|
| Q |
195 |
tctaggtggcaatgaagcatct |
216 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6994509 |
tctaggtggcaatgaagcatct |
6994530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University