View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18949_low_6 (Length: 414)
Name: NF18949_low_6
Description: NF18949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18949_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 348
Target Start/End: Complemental strand, 23517707 - 23517384
Alignment:
| Q |
25 |
catttaacattctcaaaccctttcttccttccattttcaatcttcaaaccttcttcatctctctaattgtaagtattcaaatacnnnnnnnnnnnnnnnn |
124 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23517707 |
catttaacattctcaaaccctttcttcattccattttcaatcttcaaaccttcttcatctctctaattgtaagtattcaaatacctctctcttctcttct |
23517608 |
T |
 |
| Q |
125 |
nntgtttgttttgtgtgttttcttcatatgggctttcaatttgttcattaatcaatggatcctttaactgtcagtaaccaaaaaactactatcttgcatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
23517607 |
cttgtttgttttgtgtgttttcttcatatgggctttcaacttattcattaatcaatggatcctttaactgtcaataaccaaaaaactactatcatgcatt |
23517508 |
T |
 |
| Q |
225 |
gctttcagatgtggttaatgttaaaaaacatgaaaaattctgatccttannnnnnnnnnnnccatttctatgttactgtcattttaacaatgttgtcttg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23517507 |
gctttcagatgtggttaatgttaaaaaacatgaaaaattctgatccttatttttgttttttccatttctatgttactgtcattttaacaatgttgtcttg |
23517408 |
T |
 |
| Q |
325 |
tgtttgcttatcttaagctttgtt |
348 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23517407 |
tgtttgcttatcttaagctttgtt |
23517384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University