View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_high_31 (Length: 320)
Name: NF1894_high_31
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 275
Target Start/End: Original strand, 3968009 - 3968289
Alignment:
| Q |
10 |
ataattctcatagcaagtttttggtggtatctttcatatccatggctgaagttctgaattatactctcattttcacactagggaccacgtttcc------ |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968009 |
ataattctcatagcaagtttttggtggtatctttcatatccatggctgaagttctgaattatactctcattttcacactagggaccacgtttccattctg |
3968108 |
T |
 |
| Q |
104 |
---------attctagtttaatccaatactgtcttgctcccacacttgttctttaagtttgagtatccaccataagtaaaaagcataattggaggaataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968109 |
gcaccttccattctagtttaatccaatactgtcttgctcacacacttgttctttaagtttgagtatccaccataagtaaaaagcataattggaggaataa |
3968208 |
T |
 |
| Q |
195 |
attaagctcgtgggtgagtgatgcatataaaacaagattgccaatgtcaccagaaacatctgttaattattccattttaac |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3968209 |
attaagctcgtgggtgagtgatgcatataaaacaagattgccaatgtcaccagaaacatctgttaattattccatgttaac |
3968289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University