View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1894_high_54 (Length: 250)
Name: NF1894_high_54
Description: NF1894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1894_high_54 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 15616566 - 15616815
Alignment:
| Q |
1 |
aatatatttttatggttttgctttatacaccatttttatgctacttcgttcacttccaagcttttcttttgttcagaa-cattcctttaacattctgaac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||| |||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15616566 |
aatatatttttatggttttgctttatacaccctttttatgcgacttcgttgactttcaagctattcttttgttcagaaacattcctttaacattctgaac |
15616665 |
T |
|
| Q |
100 |
aactttttcttnnnnnnnncattataaacaacttttattaaacattttttatttaaaatagcaactcacatatatattttaaaacgctaaaacacctgtt |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15616666 |
aactttttcttaaaaaaaacattataaacaacttttattaaacattttttatttaaaatagcaactcacatatatattttaaaacgttaaaacacctgtt |
15616765 |
T |
|
| Q |
200 |
gatttgtgtacggctgtgttagggaaacaaaggtttgaaatttcagataac |
250 |
Q |
| |
|
|||||||||| |||| ||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
15616766 |
gatttgtgtatggctatgttaggaaaac-aagatttgaaatttcagataac |
15616815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University